MirGeneDB

MirGeneDB ID

Aca-Mir-29-P2b-v2

Family name MIR-29 (all species)
Seed UAGCACC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-29b-1
Paralogues Aca-Mir-29-P1a  Aca-Mir-29-P1b  Aca-Mir-29-P2a  Aca-Mir-29-P2b-v1 
Orthologues Aae-Mir-29-P2  Ami-Mir-29-P2b-v1  Ami-Mir-29-P2b-v2  Asu-Mir-29-P2  Bfl-Mir-29-P2  Bta-Mir-29-P2b5  Bta-Mir-29-P2b6  Cbr-Mir-29-P2  Cel-Mir-29-P2  Cfa-Mir-29-P2b-v1  Cfa-Mir-29-P2b-v2  Cgi-Mir-29-P2  Cli-Mir-29-P2b-v1  Cli-Mir-29-P2b-v2  Cpi-Mir-29-P2b-v1  Cpi-Mir-29-P2b-v2  Cpo-Mir-29-P2b  Cte-Mir-29-P2  Dan-Mir-29-P2  Dme-Mir-29-P2  Dmo-Mir-29-P2  Dno-Mir-29-P2b-v1  Dno-Mir-29-P2b-v2  Dre-Mir-29-P2b1  Dre-Mir-29-P2b2  Ete-Mir-29-P2b-v1  Ete-Mir-29-P2b-v2  Gga-Mir-29-P2b-v1  Gga-Mir-29-P2b-v2  Hme-Mir-29-P2  Hsa-Mir-29-P2b-v1  Hsa-Mir-29-P2b-v2  Mdo-Mir-29-P2b-v1  Mdo-Mir-29-P2b-v2  Mml-Mir-29-P2b-v1  Mml-Mir-29-P2b-v2  Mmu-Mir-29-P2b  Oan-Mir-29-P2b-v1  Oan-Mir-29-P2b-v2  Ocu-Mir-29-P2b  Pfl-Mir-29-P2  Pmi-Mir-29-P2  Rno-Mir-29-P2b3  Rno-Mir-29-P2b4  Sha-Mir-29-P2b-v1  Sha-Mir-29-P2b-v2  Sko-Mir-29-P2  Spu-Mir-29-P2  Sto-Mir-29-P2b  Tca-Mir-29-P2  Tgu-Mir-29-P2b-v1  Tgu-Mir-29-P2b-v2  Xtr-Mir-29-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
GL343255.1: 1940197-1940258 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-29-P2b-v2)
Mir-29-P2b-v1 GL343255.1: 1940196-1940259 [+] UCSC Ensembl
Mir-29-P2b-v2 GL343255.1: 1940197-1940258 [+] UCSC Ensembl
Mir-29-P1b GL343255.1: 1943488-1943547 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAACACAGGUGUGUGUCUUCCUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUCUAGGAGCAAGAAUUACAGCACUGGAUGU
Get precursor sequence
Structure
        10             20        30        40        50        60
CAACACAGGUGUGUGUC-----|    CU   A          C      G  U    UUUUCC 
                      UUCCU  GGA GCUGGUUUCA AUGGUG CU AGAU      A
                      GAGGA  CUU UGACUAAAGU UACCAC GA UCUA      U
UGUAGGUCACGACAUUAAGAAC^    U-   G          U      -  -    UGUUUC 
120       110       100         90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-29-P2b-v2_5p*

MirBase accessionNone
Sequence
0- UGGUUUCACAUGGUGGCUUAGAU -23
Get sequence
Mature sequence

Aca-Mir-29-P2b-v2_3p

MirBase accessionMIMAT0021914
Sequence
39- CUAGCACCAUUUGAAAUCAGUGU -62
Get sequence