MirGeneDB

MirGeneDB ID

Aca-Mir-24-P1

Family name MIR-24 (all species)
Seed GGCUCAG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-24-1
Paralogues Aca-Mir-24-P2 
Orthologues Ami-Mir-24-P1  Bta-Mir-24-P1  Cfa-Mir-24-P1  Cpi-Mir-24-P1  Cpo-Mir-24-P1  Dno-Mir-24-P1  Dre-Mir-24-P1  Ete-Mir-24-P1  Hsa-Mir-24-P1  Mdo-Mir-24-P1  Mml-Mir-24-P1  Mmu-Mir-24-P1  Oan-Mir-24-P1  Ocu-Mir-24-P1  Rno-Mir-24-P1  Sha-Mir-24-P1  Sto-Mir-24-o1  Sto-Mir-24-P1  Xtr-Mir-24-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
2: 29157652-29157711 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-24-P1)
Mir-24-P1 2: 29157652-29157711 [-] UCSC Ensembl
Mir-27-P1 2: 29157937-29157998 [-] UCSC Ensembl
Mir-23-P1 2: 29158349-29158408 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCUGGCUUCCUCUGCAGGGCUUGGCCUUCCGUGCCUACUGAGCUGAUACUCAGUUGCUUUAGAUAAACUGGCUCAGUUCAGCAGGAACAGGAGUCCAGCCCAGUCCAUGCAAGGACUCAA
Get precursor sequence
Structure
        10           20        30        40        50        60
CCUGGCUUCCUCUGCAG---|   U  C    C  G   A         UAC     UGCUU 
                    GGCU GG CUUC GU CCU CUGAGCUGA   UCAGU     U
                    CCGA CC GAGG CA GGA GACUUGACU   GGUCA     A
AACUCAGGAACGUACCUGAC^   -  U    A  A   C         C--     AAUAG 
.       110       100         90        80          70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-24-P1_5p*

MirBase accessionMIMAT0021899
Sequence
0- GUGCCUACUGAGCUGAUACUCAGU -24
Get sequence
Mature sequence

Aca-Mir-24-P1_3p

MirBase accessionMIMAT0021900
Sequence
38- UGGCUCAGUUCAGCAGGAACAG -60
Get sequence