MirGeneDB

MirGeneDB ID

Aca-Mir-23-P1

Family name MIR-23 (all species)
Seed UCACAUU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-23a
Paralogues Aca-Mir-23-P2 
Orthologues Ami-Mir-23-P1  Bta-Mir-23-P1  Cfa-Mir-23-P1  Cpi-Mir-23-P1  Cpo-Mir-23-P1  Dno-Mir-23-P1  Dre-Mir-23-P1  Ete-Mir-23-P1  Hsa-Mir-23-P1  Mdo-Mir-23-P1  Mml-Mir-23-P1  Mmu-Mir-23-P1  Oan-Mir-23-P1  Rno-Mir-23-P1  Sha-Mir-23-P1  Sto-Mir-23-o1  Sto-Mir-23-P1  Xtr-Mir-23-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
2: 29158349-29158408 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-23-P1)
Mir-24-P1 2: 29157652-29157711 [-] UCSC Ensembl
Mir-27-P1 2: 29157937-29157998 [-] UCSC Ensembl
Mir-23-P1 2: 29158349-29158408 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGAUGUCUCUAUAUUGUGCCGCUGCCAGCUGGGGUUCCUGGUGAUGUGAUUUUAUUUUGGUGUUCAGAAUCACAUUGCCAGGGAUUUCCAACCAUCAGUGAGCUACCGCACCUGAGAAGU
Get precursor sequence
Structure
        10         20        30         40        50         
AGAUGUCUCUAUAUUGUGC-     CCAGC   -|        UG         UAUUUU 
                    CGCUG     UGG GGUUCCUGG  AUGUGAUUU      G
                    GUGAC     ACC UUAGGGACC  UACACUAAG      G
UGAAGAGUCCACGCCAUCGA     UACCA   U^        GU         ACUUGU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-23-P1_5p*

MirBase accessionMIMAT0021895
Sequence
0- GGGGUUCCUGGUGAUGUGAUUU -22
Get sequence
Mature sequence

Aca-Mir-23-P1_3p

MirBase accessionMIMAT0021896
Sequence
38- AUCACAUUGCCAGGGAUUUCCA -60
Get sequence