MirGeneDB

MirGeneDB ID

Aca-Mir-221-P3

Family name MIR-221 (all species)
Seed GCUACAU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID
Paralogues Aca-Mir-221-P1  Aca-Mir-221-P2 
Orthologues Ami-Mir-221-P3  Cli-Mir-221-P3  Cpi-Mir-221-P3  Dre-Mir-221-P3  Gga-Mir-221-P3  Oan-Mir-221-P3  Sto-Mir-221-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343528.1: 405279-405342 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGGACUCCUUGGGAUUGGAUGCCAAUGGGCUGCUCAGUAGUCGGUGUAGAAUCUGUCUGAUGAUACCCACAGCUACAUCUGAUUACUGGGUUUCCUGUGGCAUCAGGAAUCUGCGAUCGCCGAU
Get precursor sequence
Structure
        10           20        30        40         50        60 
AGGACUCCUUGGGAUUG---|      A    CU             -     AAUCUGUCUGA 
                    GAUGCCA UGGG  GCUCAGUAGUCGG UGUAG           \
                    CUACGGU GUCC  UGGGUCAUUAGUC ACAUC           U
UAGCCGCUAGCGUCUAAGGA^      -    UU             U     GACACCCAUAG 
  120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-221-P3_5p*

MirBase accessionNone
Sequence
0- UGCUCAGUAGUCGGUGUAGAAUC -23
Get sequence
Mature sequence

Aca-Mir-221-P3_3p

MirBase accessionNone
Sequence
40- AGCUACAUCUGAUUACUGGGUUUC -64
Get sequence