MirGeneDB

MirGeneDB ID

Aca-Mir-221-P1

Family name MIR-221 (all species)
Seed GCUACAU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-221
Paralogues Aca-Mir-221-P2  Aca-Mir-221-P3 
Orthologues Ami-Mir-221-P1  Bta-Mir-221-P1  Cfa-Mir-221-P1  Cli-Mir-221-P1  Cpi-Mir-221-P1  Cpo-Mir-221-P1  Dno-Mir-221-P1  Dre-Mir-221-P1a  Ete-Mir-221-P1  Gga-Mir-221-P1  Hsa-Mir-221-P1  Mdo-Mir-221-P1  Mml-Mir-221-P1  Mmu-Mir-221-P1  Oan-Mir-221-P1  Ocu-Mir-221-P1  Rno-Mir-221-P1  Sha-Mir-221-P1  Sto-Mir-221-P1  Tgu-Mir-221-P1  Xtr-Mir-221-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
3: 135996388-135996448 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-221-P1)
Mir-221-P1 3: 135996388-135996448 [-] UCSC Ensembl
Mir-221-P2 3: 135997332-135997394 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGGAAAUAGUCAUCCAGCCUUGGGGCCUGAACCUGGCAUACAAUGUAGAAUUCUGUUUGUUAAGCAACAGCUACAUUGUCUGCUGGGUUUCAGGCUGUCUGGAAAUACAAAGACAAUCUGC
Get precursor sequence
Structure
        10          20         30        40        50         
UGGAAAUAGUCAUCCAG--  UUGG      -|   UG   U         AAUUCUGUUU 
                   CC    GGCCUG AACC  GCA ACAAUGUAG          G
                   GG    UCGGAC UUGG  CGU UGUUACAUC          U
CGUCUAACAGAAACAUAAA  UCUG      U^   GU   C         GACAACGAAU 
 .       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-221-P1_5p*

MirBase accessionMIMAT0021889
Sequence
0- ACCUGGCAUACAAUGUAGAAUUC -23
Get sequence
Mature sequence

Aca-Mir-221-P1_3p

MirBase accessionMIMAT0021890
Sequence
38- AGCUACAUUGUCUGCUGGGUUUC -61
Get sequence