MirGeneDB

MirGeneDB ID

Aca-Mir-22-P1a

Family name MIR-22 (all species)
Seed AGCUGCC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID
Paralogues
Orthologues Bfl-Mir-22-P1  Bta-Mir-22-P1a  Cfa-Mir-22-P1a  Cgi-Mir-22-P1  Cli-Mir-22-P1a  Cpi-Mir-22-P1a  Cpo-Mir-22-P1a  Cte-Mir-22-P1  Dno-Mir-22-P1a  Dre-Mir-22-P1a  Ete-Mir-22-P1a  Gga-Mir-22-P1a  Hsa-Mir-22-P1a  Lan-Mir-22-P1  Lgi-Mir-22-P1  Mdo-Mir-22-P1a  Mml-Mir-22-P1a  Mmu-Mir-22-P1a  Oan-Mir-22-P1a  Ocu-Mir-22-P1a  Pfl-Mir-22-P1  Pmi-Mir-22-P1  Rno-Mir-22-P1a  Sha-Mir-22-P1a  Sto-Mir-22-P1a  Xtr-Mir-22-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
SRR150218727584143: 38-101 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUUCUUACCUUCCUCUGGCCCCCGCGCAGCAGUUCUUCAGCGGCAUCGCUUUACGUCCCCUUUAAGAAGCUAAAGCUGCCAGUUGAAGAACUGUUGGCCGGGGCCCCACGCCACCAGGAAGAGG
Get precursor sequence
Structure
        10           20        30        40         50        60  
CUUCUUACCUUCCUCUG---|    C  G               -    UC      CGUCCCCU 
                    GCCCC GC CAGCAGUUCUUCAGC GGCA  GCUUUA        \
                    CGGGG CG GUUGUCAAGAAGUUG CCGU  CGAAAU        U
GGAGAAGGACCACCGCACCC^    C  -               A    --      CGAAGAAU 
  120       110       100         90        80          70
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-22-P1a_5p*

MirBase accessionNone
Sequence
0- AGUUCUUCAGCGGCAUCGCUUUA -23
Get sequence
Mature sequence

Aca-Mir-22-P1a_3p

MirBase accessionNone
Sequence
42- AAGCUGCCAGUUGAAGAACUGU -64
Get sequence