MirGeneDB

MirGeneDB ID

Aca-Mir-219-P1

Family name MIR-219 (all species)
Seed GAUUGUC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-219-2
Paralogues Aca-Mir-219-P2 
Orthologues Aae-Mir-219  Ami-Mir-219-P1  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P1  Cfa-Mir-219-P1  Cgi-Mir-219  Cin-Mir-219  Cpi-Mir-219-P1  Cpo-Mir-219-P1  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P1  Dpu-Mir-219  Dre-Mir-219-P1a  Ete-Mir-219-P1  Hsa-Mir-219-P1  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P1  Mml-Mir-219-P1  Mmu-Mir-219-P1  Mmu-Mir-219-P1-as  Ocu-Mir-219-P1  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P1  Sha-Mir-219-P1  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P1-v1  Sto-Mir-219-P1-v2  Tca-Mir-219 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
GL344404.1: 891-949 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGCGAGGAAGGAGCGCUGACCGCUGGGUCCUGAUUGUCCAAACGCAAUUCUUGUCUCCGCUCCACCGAGAGUUGAGUCUGGACAUCAGGAGCCGGAGGUUGGGUGGACGCCAAACCCAG
Get precursor sequence
Structure
        10          20        30        40        50         
AGCGAGGAAGGAGCGCU--|   G    G       U     A  G         UCUCC 
                   GACC CUGG UCCUGAU GUCCA AC CAAUUCUUG     G
                   UUGG GGCC AGGACUA CAGGU UG GUUGAGAGC     C
GACCCAAACCGCAGGUGGG^   A    G       -     C  A         CACCU 
       110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-219-P1_5p

MirBase accessionMIMAT0021884
Sequence
0- UGAUUGUCCAAACGCAAUUCUUG -23
Get sequence
Star sequence

Aca-Mir-219-P1_3p*

MirBase accessionMIMAT0021886
Sequence
37- AGAGUUGAGUCUGGACAUCAGG -59
Get sequence