MirGeneDB

MirGeneDB ID

Aca-Mir-216-P1a

Family name MIR-216 (all species)
Seed AAUCUCA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-216a
Paralogues Aca-Mir-216-P1b 
Orthologues Aae-Mir-216-P1  Ami-Mir-216-P1a  Asu-Mir-216-P1  Bfl-Mir-216-P1  Bge-Mir-216-P1  Bta-Mir-216-P1a  Cbr-Mir-216-P1  Cel-Mir-216-P1  Cfa-Mir-216-P1a  Cgi-Mir-216-P1  Cli-Mir-216-P1a  Cpi-Mir-216-P1a  Cpo-Mir-216-P1a  Dan-Mir-216-P1  Dme-Mir-216-P1  Dmo-Mir-216-P1  Dno-Mir-216-P1a  Dpu-Mir-216-P1  Dre-Mir-216-P1a  Efe-Mir-216-P1  Ete-Mir-216-P1a  Gga-Mir-216-P1a  Hme-Mir-216-P1  Hsa-Mir-216-P1a  Isc-Mir-216-P1  Lgi-Mir-216-P1  Mdo-Mir-216-P1a  Mml-Mir-216-P1a  Mmu-Mir-216-P1a  Oan-Mir-216-P1a  Ocu-Mir-216-P1a  Rno-Mir-216-P1a  Sha-Mir-216-P1a  Sto-Mir-216-P1a  Tca-Mir-216-P1  Tgu-Mir-216-P1a  Xtr-Mir-216-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
1: 256236305-256236366 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-216-P1a)
Mir-217-v2 1: 256233879-256233939 [-] UCSC Ensembl
Mir-217-v1 1: 256233880-256233938 [-] UCSC Ensembl
Mir-216-P1a 1: 256236305-256236366 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGCACUUCCAAGGAUGGCUGUGAAUUGGUUUAAUCUCAGCUGGCAACUGUGAGCAGUUUCCAAAUCCUCUCACAGUGGUUUCUGGGAUUAUGCUAAACACAGCAAUUUCAUGGCUUGCGUGG
Get precursor sequence
Structure
        10           20        30        40        50        60 
CGCACUUCCAAGGAUGG---|    AA     U         CU   A        CAGUUUC 
                    CUGUG  UUGGU UAAUCUCAG  GGC ACUGUGAG       \
                    GACAC  AAUCG AUUAGGGUC  UUG UGACACUC       C
GGUGCGUUCGGUACUUUAAC^    A-     U         U-   G        UCCUAAA 
120       110       100         90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-216-P1a_5p

MirBase accessionMIMAT0021875
Sequence
0- UAAUCUCAGCUGGCAACUGUGAG -23
Get sequence
Star sequence

Aca-Mir-216-P1a_3p*

MirBase accessionNone
Sequence
40- CACAGUGGUUUCUGGGAUUAUG -62
Get sequence