MirGeneDB

MirGeneDB ID

Aca-Mir-208-P1

Family name MIR-208 (all species)
Seed UAAGACG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-208
Paralogues
Orthologues Ami-Mir-208-P1  Bta-Mir-208-P1  Cfa-Mir-208-P1  Cpi-Mir-208-P1  Cpo-Mir-208-P1  Dno-Mir-208-P1  Ete-Mir-208-P1  Hsa-Mir-208-P1  Mdo-Mir-208-P1  Mml-Mir-208-P1  Mmu-Mir-208-P1  Oan-Mir-208-P1  Ocu-Mir-208-P1  Rno-Mir-208-P1  Sha-Mir-208-P1  Xtr-Mir-208-P1 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343680.1: 158525-158584 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CACUCUUCACAGGUGUUUCCUCUAACAAGGAAGCUUUUGGCUCGGGUUAUAUUUUAGAAUGGCAGUGUAUAAGACGAGCAAAAAGCUUGUUGGUUGGAGGAGAAGUCCCCAUUUUAAAAG
Get precursor sequence
Structure
        10          20        30        40        50         
CACUCUUCACAGGUGUU--|        A  G        G     GG      UUUAGA 
                   UCCUCUAAC AG AAGCUUUU GCUCG  UUAUAU      A
                   AGGAGGUUG UU UUCGAAAA CGAGC  AAUAUG      U
GAAAAUUUUACCCCUGAAG^        G  G        A     AG      UGACGG 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-208-P1_5p*

MirBase accessionMIMAT0021859
Sequence
0- AAGCUUUUGGCUCGGGUUAUAU -22
Get sequence
Mature sequence

Aca-Mir-208-P1_3p

MirBase accessionMIMAT0021860
Sequence
38- AUAAGACGAGCAAAAAGCUUGU -60
Get sequence