MirGeneDB

MirGeneDB ID

Aca-Mir-205-P1

Family name MIR-205 (all species)
Seed CCUUCAU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-205a
Paralogues Aca-Mir-205-P2 
Orthologues Ami-Mir-205-P1  Bta-Mir-205-P1  Cfa-Mir-205-P1  Cli-Mir-205-P1  Cpi-Mir-205-P1  Cpo-Mir-205-P1  Dno-Mir-205-P1  Dre-Mir-205-P1  Ete-Mir-205-P1  Gga-Mir-205-P1  Hsa-Mir-205-P1  Mdo-Mir-205-P1  Mml-Mir-205-P1  Mmu-Mir-205-P1  Oan-Mir-205-P1  Ocu-Mir-205-P1  Rno-Mir-205-P1  Sha-Mir-205-P1  Sto-Mir-205-P1  Tgu-Mir-205-P1a  Tgu-Mir-205-P1b  Xtr-Mir-205-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
4: 125660749-125660807 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAAACAAAGAAUAUUCCAUGAGUUCUAUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUAUCUAAUCAGAUUUCAGUGGAGUGAAGCACAAGAGACAUGGAGUUGAAUCCACUGAGACUU
Get precursor sequence
Structure
        10        20           30        40        50         
CAAACAAAGAAUAUUCCAUGA---| U  A    C           C        UCUCAU 
                        GU CU UUGU CUUCAUUCCAC GGAGUCUG      \
                        CA GA AACA GAAGUGAGGUG CUUUAGAC      A
UUCAGAGUCACCUAAGUUGAGGUA^ -  G    C           A        UAAUCU 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-205-P1_5p

MirBase accessionMIMAT0021855
Sequence
0- UCCUUCAUUCCACCGGAGUCUG -22
Get sequence
Star sequence

Aca-Mir-205-P1_3p*

MirBase accessionNone
Sequence
37- GAUUUCAGUGGAGUGAAGCACA -59
Get sequence