MirGeneDB

MirGeneDB ID

Aca-Mir-193-P2a

Family name MIR-193 (all species)
Seed AAUGCCC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-365
Paralogues Aca-Mir-193-P1a 
Orthologues Ami-Mir-193-P2a  Bge-Mir-193-P2  Bta-Mir-193-P2a  Cbr-Mir-193-P2-v1  Cbr-Mir-193-P2-v2  Cel-Mir-193-P2-v1  Cel-Mir-193-P2-v2  Cfa-Mir-193-P2a  Cgi-Mir-193-P2  Cli-Mir-193-P2a  Cpi-Mir-193-P2a  Cpo-Mir-193-P2a  Cte-Mir-193-P2  Dno-Mir-193-P2a  Dre-Mir-193-P2a1  Dre-Mir-193-P2a2  Ete-Mir-193-P2a  Gga-Mir-193-P2a  Hme-Mir-193-P2  Hsa-Mir-193-P2a  Lgi-Mir-193-P2  Mml-Mir-193-P2a  Mmu-Mir-193-P2a  Oan-Mir-193-P2a  Ocu-Mir-193-P2a  Pfl-Mir-193-P2  Pmi-Mir-193-P2  Rno-Mir-193-P2a  Sha-Mir-193-P2a  Sko-Mir-193-P2  Tca-Mir-193-P2  Tgu-Mir-193-P2a 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
GL343198.1: 1087521-1087582 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGAGACACCGAGAGGCAGCAAGAAAAAUGAGGGACUUUCAGGGGCAGCUGUGUUUUACUAACCCAGUCAUAAUGCCCCUAAAAAUCCUUAUUGUUCUUGCAAUGUUCAGCUAUGAUCACCA
Get precursor sequence
Structure
        10           20        30        40        50        60 
GAGAGACACCGAGAGGCA---|      A        AC   C       GC    UUUUACU 
                     GCAAGAA AAUGAGGG  UUU AGGGGCA  UGUG       \
                     CGUUCUU UUAUUCCU  AAA UCCCCGU  AUAC       A
ACCACUAGUAUCGACUUGUAA^      G        AA   -       A-    UGACCCA 
120       110       100        90         80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-193-P2a_5p*

MirBase accessionMIMAT0021947
Sequence
0- AGGGACUUUCAGGGGCAGCUGUG -23
Get sequence
Mature sequence

Aca-Mir-193-P2a_3p

MirBase accessionMIMAT0021948
Sequence
40- UAAUGCCCCUAAAAAUCCUUAU -62
Get sequence