MirGeneDB

MirGeneDB ID

Aca-Mir-190-P2

Family name MIR-190 (all species)
Seed GAUAUGU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-190b
Paralogues Aca-Mir-190-P1 
Orthologues Aae-Mir-190  Ami-Mir-190-P2  Asu-Mir-190  Bfl-Mir-190  Bge-Mir-190  Bta-Mir-190-P2  Cbr-Mir-190  Cel-Mir-190  Cfa-Mir-190-P2  Cgi-Mir-190  Cpi-Mir-190-P2  Cpo-Mir-190-P2  Cte-Mir-190  Dan-Mir-190  Dme-Mir-190  Dmo-Mir-190  Dno-Mir-190-P2  Dpu-Mir-190  Dre-Mir-190-P2  Ete-Mir-190-P2  Gga-Mir-190-P2  Hme-Mir-190  Hsa-Mir-190-P2  Isc-Mir-190  Mdo-Mir-190-P2  Mml-Mir-190-P2  Mmu-Mir-190-P2  Oan-Mir-190-P2  Ocu-Mir-190-P2  Pfl-Mir-190  Pmi-Mir-190  Rno-Mir-190-P2  Sha-Mir-190-P2  Sko-Mir-190  Sto-Mir-190-P2  Tca-Mir-190  Tgu-Mir-190-P2  Xtr-Mir-190-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
G889P63465RJ23: 337-397 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCUGCAGCUGACCCUCCCCCUGCUUCUGUCUGAUAUGUUUGAUAUUAGGUUGUUCUACUGGGAAACCAACUAAAUAUCAAACAUAUUCUUACAGCGCCAGGGCCCUUCCCACGCACCCCGG
Get precursor sequence
Structure
        10          20        30         40        50         
CCUGCAGCUGACCCUCC--     CUU    CU -|             A     UUCUAC 
                   CCCUG   CUGU  G AUAUGUUUGAUAUU GGUUG      U
                   GGGAC   GACA  C UAUACAAACUAUAA UCAAC      G
GGCCCCACGCACCCUUCCC     CGC    UU U^             A     CAAAGG 
 .       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive.
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-190-P2_5p

MirBase accessionMIMAT0021823
Sequence
0- UGAUAUGUUUGAUAUUAGGUUG -22
Get sequence
Star sequence

Aca-Mir-190-P2_3p* (predicted)

MirBase accessionNone
Sequence
38- ACUAAAUAUCAAACAUAUUCUUA -61
Get sequence