MirGeneDB

MirGeneDB ID

Aca-Mir-19-P2b

Family name MIR-19 (all species)
Seed GUGCAAA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID
Paralogues Aca-Mir-19-P1  Aca-Mir-19-P2a 
Orthologues Bta-Mir-19-P2b  Cfa-Mir-19-P2b  Cli-Mir-19-P2b  Cpi-Mir-19-P2b  Cpo-Mir-19-P2b  Dno-Mir-19-P2b  Dre-Mir-19-P2b1  Ete-Mir-19-P2b  Gga-Mir-19-P2b  Hsa-Mir-19-P2b  Mdo-Mir-19-P2b  Mml-Mir-19-P2b  Mmu-Mir-19-P2b  Oan-Mir-19-P2b  Ocu-Mir-19-P2b  Rno-Mir-19-P2b  Sha-Mir-19-P2b  Sto-Mir-19-P2b  Tgu-Mir-19-P2b  Xtr-Mir-19-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL344214.1: 24242-24302 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P2b)
Mir-17-P2b GL344214.1: 22479-22543 [+] UCSC Ensembl
Mir-17-P3b GL344214.1: 24042-24104 [+] UCSC Ensembl
Mir-92-P1b GL344214.1: 24446-24508 [+] UCSC Ensembl
Mir-92-P2b GL344214.1: 24606-24670 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACAGACAGACCUUUGUGCUGAUCUACAGUCCGUUUUGCAGGUUUGCAUCCCAGCUUGCUGUCCGUCGCUGUGCAAAUCCAUGCAAAACUGACUGUGGUGGUAGUUGUGAGCGGUAAAGGAU
Get precursor sequence
Structure
        10         20         30         40         50        60
ACAGACAGACCUUUGUG-   AU-        C        -  -|     UCC    UUGCU 
                  CUG   CUACAGUC GUUUUGCA GG UUUGCA   CAGC     G
                  GAU   GGUGUCAG CAAAACGU CC AAACGU   GUCG     U
UAGGAAAUGGCGAGUGUU   GGU        U        A  U^     ---    CUGCC 
 .       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-19-P2b_5p*

MirBase accessionNone
Sequence
0- CGUUUUGCAGGUUUGCAUCCCAGC -24
Get sequence
Mature sequence

Aca-Mir-19-P2b_3p

MirBase accessionNone
Sequence
38- UGUGCAAAUCCAUGCAAAACUGA -61
Get sequence