MirGeneDB

MirGeneDB ID

Aca-Mir-19-P1

Family name MIR-19 (all species)
Seed GUGCAAA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-19a
Paralogues Aca-Mir-19-P2a  Aca-Mir-19-P2b 
Orthologues Ami-Mir-19-P1  Bta-Mir-19-P1  Cfa-Mir-19-P1  Cli-Mir-19-P1  Cpi-Mir-19-P1  Cpo-Mir-19-P1  Dno-Mir-19-P1  Dre-Mir-19-P1a  Ete-Mir-19-P1  Gga-Mir-19-P1  Hsa-Mir-19-P1  Mdo-Mir-19-P1  Mml-Mir-19-P1  Mmu-Mir-19-P1  Oan-Mir-19-P1  Ocu-Mir-19-P1  Rno-Mir-19-P1  Sha-Mir-19-P1  Sto-Mir-19-P1  Tgu-Mir-19-P1  Xtr-Mir-19-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343584.1: 108539-108596 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P1)
Mir-17-P1a GL343584.1: 108268-108328 [+] UCSC Ensembl
Mir-19-P1 GL343584.1: 108539-108596 [+] UCSC Ensembl
Mir-17-P3a GL343584.1: 108699-108757 [+] UCSC Ensembl
Mir-19-P2a GL343584.1: 108837-108897 [+] UCSC Ensembl
Mir-92-P1a GL343584.1: 108950-109010 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUAAAACCUAAUGUUUUGCAGUCCUCUGUUAGUUUUGCAUAGUUGCACUACAAGAAGAAUGUAGUUGUGCAAAUCUAUGCAAAACUGAUUGUGGCCUGUUAUUGUCUGCAUUUCAAGC
Get precursor sequence
Structure
        10          20        30        40          50       
CUAAAACCUAAUGUUUU--    U  UCU               --|     U  AAGAA 
                   GCAG CC   GUUAGUUUUGCAUAG  UUGCAC AC     G
                   UGUC GG   UAGUCAAAACGUAUC  AACGUG UG     A
CGAACUUUACGUCUGUUAU    C  UGU               UA^     U  AUGUA 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-19-P1_5p*

MirBase accessionMIMAT0021836
Sequence
0- AGUUUUGCAUAGUUGCACUAC -21
Get sequence
Mature sequence

Aca-Mir-19-P1_3p

MirBase accessionMIMAT0021837
Sequence
35- UGUGCAAAUCUAUGCAAAACUGA -58
Get sequence