MirGeneDB

MirGeneDB ID

Aca-Mir-17-P3b

Family name MIR-17 (all species)
Seed AAAGUGC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-20b
Paralogues Aca-Mir-17-P1a  Aca-Mir-17-P1b  Aca-Mir-17-P2a  Aca-Mir-17-P2b  Aca-Mir-17-P3a 
Orthologues Bta-Mir-17-P3b  Cfa-Mir-17-P3b  Cli-Mir-17-P3b  Cpi-Mir-17-P3b  Cpo-Mir-17-P3b  Dno-Mir-17-P3b  Dre-Mir-17-P3b1  Ete-Mir-17-P3b  Gga-Mir-17-P3b  Hsa-Mir-17-P3b  Mdo-Mir-17-P3b  Mml-Mir-17-P3b  Mmu-Mir-17-P3b  Oan-Mir-17-P3b  Ocu-Mir-17-P3b  Rno-Mir-17-P3b  Sha-Mir-17-P3b  Tgu-Mir-17-P3b  Xtr-Mir-17-P3b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL344214.1: 24042-24104 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-17-P3b)
Mir-17-P2b GL344214.1: 22479-22543 [+] UCSC Ensembl
Mir-17-P3b GL344214.1: 24042-24104 [+] UCSC Ensembl
Mir-92-P1b GL344214.1: 24446-24508 [+] UCSC Ensembl
Mir-92-P2b GL344214.1: 24606-24670 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCCUCGUCGAGAUCCCUAUCCUCGCAGUGUCAAAGUGCUCAUAGUGCAGGUAGUUAAUGCACCCAAAUCUACUGUAAUGUGGGCACUUACAGUACUGCCGGAUCCAGAGCAUCCUAUUUGGCG
Get precursor sequence
Structure
        10           20        30         40        50        60 
UCCUCGUCGAGAUCCCU---|   UC      UCA-           G     G   UUAAUGC 
                    AUCC  GCAGUG    AAGUGCUCAUA UGCAG UAG       \
                    UAGG  CGUCAU    UUCACGGGUGU AUGUC AUC       A
GCGGUUUAUCCUACGAGACC^   C-      GACA           A     -   UAAACCC 
 120       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-17-P3b_5p

MirBase accessionMIMAT0021863
Sequence
0- CAAAGUGCUCAUAGUGCAGGUAG -23
Get sequence
Star sequence

Aca-Mir-17-P3b_3p*

MirBase accessionMIMAT0021864
Sequence
40- ACUGUAAUGUGGGCACUUACAGU -63
Get sequence