MirGeneDB

MirGeneDB ID

Aca-Mir-17-P3a

Family name MIR-17 (all species)
Seed AAAGUGC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-20a
Paralogues Aca-Mir-17-P1a  Aca-Mir-17-P1b  Aca-Mir-17-P2a  Aca-Mir-17-P2b  Aca-Mir-17-P3b 
Orthologues Ami-Mir-17-P3a  Bta-Mir-17-P3a  Cfa-Mir-17-P3a  Cli-Mir-17-P3a  Cpi-Mir-17-P3a  Cpo-Mir-17-P3a  Dno-Mir-17-P3a  Dre-Mir-17-P3a1  Ete-Mir-17-P3a  Gga-Mir-17-P3a  Hsa-Mir-17-P3a  Mdo-Mir-17-P3a  Mml-Mir-17-P3a  Mmu-Mir-17-P3a  Oan-Mir-17-P3a3  Oan-Mir-17-P3a4  Ocu-Mir-17-P3a  Rno-Mir-17-P3a  Sha-Mir-17-P3a  Sto-Mir-17-P3a  Tgu-Mir-17-P3a1  Tgu-Mir-17-P3a2  Xtr-Mir-17-P3a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343584.1: 108699-108757 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-17-P3a)
Mir-17-P1a GL343584.1: 108268-108328 [+] UCSC Ensembl
Mir-19-P1 GL343584.1: 108539-108596 [+] UCSC Ensembl
Mir-17-P3a GL343584.1: 108699-108757 [+] UCSC Ensembl
Mir-19-P2a GL343584.1: 108837-108897 [+] UCSC Ensembl
Mir-92-P1a GL343584.1: 108950-109010 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAAUGCUUGUCGGAACAGCUCCUGUAGCACUAAAGUGCUUAUAGUGCAGGUAGUGAUUAAUAAUCUACUGCAUUACGAGCACUUAAAGUACUGCUAGCUGUAGAGCAUCAGUUUUGUCC
Get precursor sequence
Structure
        10            20        30         40        50         
GAAUGCUUGUCGGAACA----|  CCU    C   A-       UA        G   UGAUU 
                     GCU   GUAG ACU  AAGUGCU  UAGUGCAG UAG     \
                     CGA   CGUC UGA  UUCACGA  AUUACGUC AUC     A
CCUGUUUUGACUACGAGAUGU^  U--    A   AA       GC        -   UAAUA 
       110       100          90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-17-P3a_5p

MirBase accessionMIMAT0021861
Sequence
0- UAAAGUGCUUAUAGUGCAGGUAG -23
Get sequence
Star sequence

Aca-Mir-17-P3a_3p*

MirBase accessionMIMAT0021862
Sequence
36- ACUGCAUUACGAGCACUUAAAGU -59
Get sequence