MirGeneDB

MirGeneDB ID

Aca-Mir-17-P1b

Family name MIR-17 (all species)
Seed AAAGUGC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID
Paralogues Aca-Mir-17-P1a  Aca-Mir-17-P2a  Aca-Mir-17-P2b  Aca-Mir-17-P3a  Aca-Mir-17-P3b 
Orthologues Bta-Mir-17-P1b  Cfa-Mir-17-P1b  Cli-Mir-17-P1b  Cpi-Mir-17-P1b  Cpo-Mir-17-P1b  Dno-Mir-17-P1b  Ete-Mir-17-P1b  Gga-Mir-17-P1b  Hsa-Mir-17-P1b  Mdo-Mir-17-P1b  Mml-Mir-17-P1b  Mmu-Mir-17-P1b  Oan-Mir-17-P1b  Ocu-Mir-17-P1b  Rno-Mir-17-P1b  Sha-Mir-17-P1b  Tgu-Mir-17-P1b  Xtr-Mir-17-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL344214.1: 22328-22385 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-17-P1b)
Mir-17-P2b GL344214.1: 22479-22543 [+] UCSC Ensembl
Mir-17-P3b GL344214.1: 24042-24104 [+] UCSC Ensembl
Mir-92-P1b GL344214.1: 24446-24508 [+] UCSC Ensembl
Mir-92-P2b GL344214.1: 24606-24670 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUGCUUCUGGGGGGAAAGCCAUCGGGGUGCAAAAGUGCUUAUAGUGCAGGUAGUGUGUUGGCAUCUACUGCAGUGUUGGCACUUCCGUGCCACGAUGGCGAUGCGCGUCAGGUGCAAC
Get precursor sequence
Structure
        10          20        30        40        50         
GUGCUUCUGGGGGGAAA--|      G  UG AA       U   G     G   UGUGU 
                   GCCAUCG GG  C  AAGUGCU AUA UGCAG UAG     \
                   CGGUAGC CC  G  UUCACGG UGU ACGUC AUC     U
CAACGUGGACUGCGCGUAG^      A  GU CC       U   G     -   UACGG 
      110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-17-P1b_5p

MirBase accessionNone
Sequence
0- AAAAGUGCUUAUAGUGCAGGUAG -23
Get sequence
Star sequence

Aca-Mir-17-P1b_3p*

MirBase accessionNone
Sequence
36- ACUGCAGUGUUGGCACUUCCGU -58
Get sequence