MirGeneDB

MirGeneDB ID

Aca-Mir-1641

Family name MIR-1641 (all species)
Seed UGGGAUU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID
Paralogues
Orthologues Ami-Mir-1641  Cli-Mir-1641  Cpi-Mir-1641  Gga-Mir-1641  Tgu-Mir-1641 
Node of Origin (locus) Diapsida
Node of Origin (family) Diapsida
Genome context
(anoCar2)
1: 133663074-133663133 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGCAAAAACAACCUUCACACAGGGCUUUUCCUGGGAUUAAUGACAGUCUGGGGGUCAUCAUCUCCUCCCAGUUAGUUAUUAAUCCUCAGGAAACACUCAGUGCCUUGAUCGUUAUUGCUU
Get precursor sequence
Structure
        10         20        30         40        50         
AGCAAAAACAACCUUCA-   A   CU       -|          AGU     GGUCAU 
                  CAC GGG  UUUCCUG GGAUUAAUGAC   CUGGG      C
                  GUG CUC  AAAGGAC CCUAAUUAUUG   GACCC      A
UUCGUUAUUGCUAGUUCC   A   AC       U^          AUU     UCCUCU 
.       110       100        90        80        70        60
Deep sequencing
3' NTU Unknown
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-1641_5p (predicted)

MirBase accessionNone
Sequence
0- CUGGGAUUAAUGACAGUCUGGG -22
Get sequence
Star sequence

Aca-Mir-1641_3p* (predicted)

MirBase accessionNone
Sequence
37- CCAGUUAGUUAUUAAUCCUCAGG -60
Get sequence