MirGeneDB

MirGeneDB ID

Aca-Mir-140-v2

Family name MIR-140 (all species)
Seed ACCACAG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-140
Paralogues Aca-Mir-140-v1 
Orthologues Ami-Mir-140-v2  Bta-Mir-140-v2  Cfa-Mir-140-v2  Cli-Mir-140-v2  Cpi-Mir-140-v2  Cpo-Mir-140-v2  Dno-Mir-140-v2  Dre-Mir-140-v2  Ete-Mir-140-v2  Gga-Mir-140-v2  Hsa-Mir-140-v2  Mdo-Mir-140-v2  Mml-Mir-140-v2  Mmu-Mir-140-v2  Oan-Mir-140-v2  Ocu-Mir-140-v2  Rno-Mir-140-v2  Sha-Mir-140-v2  Sto-Mir-140-v2  Tgu-Mir-140-v2  Xtr-Mir-140-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343643.1: 205834-205895 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-140-v2)
Mir-140-v1 GL343643.1: 205834-205895 [+] UCSC Ensembl
Mir-140-v2 GL343643.1: 205834-205895 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACUCUCCUCCUUCCUCUCUCUGUGUCCUUCCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUUCUACCACAGGGUAGAACCACGGACGGGAUGCCGGGGCUCUCUGCGCCAGAGCAG
Get precursor sequence
Structure
        10          20         30        40        50        60
ACUCUCCUCCUUCCUCU--   U       -|  A             A       UUACGU 
                   CUC GUGUCCU UCC GUGGUUUUACCCU UGGUAGG      C
                   GGG CGUAGGG AGG CACCAAGAUGGGA ACCAUCU      A
GACGAGACCGCGUCUCUCG   C       C^  -             C       UGUCGU 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-140-v2_5p*

MirBase accessionMIMAT0021765
Sequence
0- CAGUGGUUUUACCCUAUGGUAGG -23
Get sequence
Mature sequence

Aca-Mir-140-v2_3p

MirBase accessionMIMAT0021766
Sequence
39- UACCACAGGGUAGAACCACGGAC -62
Get sequence