MirGeneDB

MirGeneDB ID

Aca-Mir-135-P3

Family name MIR-135 (all species)
Seed AUGGCUU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-135-3
Paralogues Aca-Mir-135-P1  Aca-Mir-135-P2 
Orthologues Ami-Mir-135-P3  Bta-Mir-135-P3  Cfa-Mir-135-P3  Cli-Mir-135-P3  Cpi-Mir-135-P3  Cpo-Mir-135-P3  Dno-Mir-135-P3  Dre-Mir-135-P3a  Dre-Mir-135-P3b  Ete-Mir-135-P3  Gga-Mir-135-P3  Hsa-Mir-135-P3  Mdo-Mir-135-P3  Mml-Mir-135-P3  Mmu-Mir-135-P3  Oan-Mir-135-P3  Ocu-Mir-135-P3  Rno-Mir-135-P3  Sha-Mir-135-P3  Sto-Mir-135-P3  Tgu-Mir-135-P3  Xtr-Mir-135-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Chordata
Genome context
(anoCar2)
GL343228.1: 62430-62490 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUUAUCUUCUUUAAGCCCUCUGCUGUGGUCUAUGGCUUUUUAUUCCUAUGUGAUUGCUUUUCAUAACUCAUGUAGGGCUAAAAGCCAUGGGCUACACAGAGGAAUAAUCCUCUUCUUUGGC
Get precursor sequence
Structure
        10           20        30        40        50        60
CUUAUCUUCUUUAAGCC---|    C                 UAU          UUGCUU 
                    CUCUG UGUGGUCUAUGGCUUUU   UCCUAUGUGA      U
                    GAGAC ACAUCGGGUACCGAAAA   GGGAUGUACU      U
CGGUUUCUUCUCCUAAUAAG^    -                 UC-          CAAUAC 
 .       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-135-P3_5p

MirBase accessionMIMAT0021750
Sequence
0- UAUGGCUUUUUAUUCCUAUGUGA -23
Get sequence
Star sequence

Aca-Mir-135-P3_3p*

MirBase accessionMIMAT0021753
Sequence
39- AUGUAGGGCUAAAAGCCAUGGG -61
Get sequence