MirGeneDB

MirGeneDB ID

Aca-Mir-1329

Family name MIR-1329 (all species)
Seed ACAGUGA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-1329
Paralogues
Orthologues Ami-Mir-1329  Bta-Mir-1329  Cli-Mir-1329  Cpi-Mir-1329  Gga-Mir-1329  Mdo-Mir-1329  Oan-Mir-1329  Sha-Mir-1329  Sto-Mir-1329  Tgu-Mir-1329  Xtr-Mir-1329 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
1: 147380645-147380705 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGAAUUGCUUCUGCAUCGGACUGUAGGGGUACAGUGAUCAGGUUACGAUGGAUUUCUCUAGUAACAGCCUCGUAGCUUGAUCACCAUCUCCCUAUGAUUCAGAUUACAGCUGGUUUGCUU
Get precursor sequence
Structure
        10          20        30        40        50        60
GAGAAUUGCUUCUGCAUC--|  CU       UACA               U  AUUUCUC 
                    GGA  GUAGGGG    GUGAUCAGGUUACGA GG       U
                    CUU  UAUCCCU    CACUAGUUCGAUGCU CC       A
UUCGUUUGGUCGACAUUAGA^  AG       CUAC               -  GACAAUG 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-1329_5p

MirBase accessionMIMAT0021747
Sequence
0- UACAGUGAUCAGGUUACGAUGGA -23
Get sequence
Star sequence

Aca-Mir-1329_3p*

MirBase accessionMIMAT0021748
Sequence
38- CCUCGUAGCUUGAUCACCAUCUC -61
Get sequence