MirGeneDB

MirGeneDB ID

Aca-Mir-130-P4b

Family name MIR-130 (all species)
Seed AGUGCAA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-454
Paralogues Aca-Mir-130-P1a  Aca-Mir-130-P1b  Aca-Mir-130-P2a  Aca-Mir-130-P2b  Aca-Mir-130-P3a  Aca-Mir-130-P3b 
Orthologues Ami-Mir-130-P4b  Cli-Mir-130-P4b  Cpi-Mir-130-P4b  Dre-Mir-130-P4b  Gga-Mir-130-P4b  Sto-Mir-130-P4b  Tgu-Mir-130-P4b  Xtr-Mir-130-P4b 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343282.1: 1189904-1189968 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-130-P4b)
Mir-130-P1b GL343282.1: 1188362-1188424 [-] UCSC Ensembl
Mir-130-P4b GL343282.1: 1189904-1189968 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCCACCCCCUGUGAGAACUCUGAGGAUAAGACCCUAUCAAUAUUGCCUCUGCUUCUGUGCUGGAUUCAAGUAGUGCAAUAUUGCUUAUAGGGUCUUUUCUUUGGGGAGGCGCUCUUCGUGGGAAG
Get precursor sequence
Structure
        10          20        30           40        50        60 
CCCACCCCCUGUGAGAA--   UG    U          ---|        CU     UCUGUGC 
                   CUC  AGGA AAGACCCUAU   CAAUAUUGC  CUGCU       \
                   GGG  UUCU UUCUGGGAUA   GUUAUAACG  GAUGA       U
GAAGGGUGCUUCUCGCGGA   GU    U          UUC^        U-     ACUUAGG 
   120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-130-P4b_5p*

MirBase accessionMIMAT0021962
Sequence
0- ACCCUAUCAAUAUUGCCUCUGCU -23
Get sequence
Mature sequence

Aca-Mir-130-P4b_3p

MirBase accessionMIMAT0021963
Sequence
40- UAGUGCAAUAUUGCUUAUAGGGUCU -65
Get sequence