MirGeneDB

MirGeneDB ID

Aca-Mir-130-P3b

Family name MIR-130 (all species)
Seed AGUGCAA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-130c
Paralogues Aca-Mir-130-P1a  Aca-Mir-130-P1b  Aca-Mir-130-P2a  Aca-Mir-130-P2b  Aca-Mir-130-P3a  Aca-Mir-130-P4b 
Orthologues Ami-Mir-130-P3b  Cli-Mir-130-P3b  Cpi-Mir-130-P3b  Dre-Mir-130-P3b1  Dre-Mir-130-P3b2  Gga-Mir-130-P3b  Oan-Mir-130-P3b  Sto-Mir-130-P3b  Tgu-Mir-130-P3b  Xtr-Mir-130-P3b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343282.1: 1201646-1201704 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-130-P3b)
Mir-130-P2b GL343282.1: 1200203-1200263 [-] UCSC Ensembl
Mir-130-P3b GL343282.1: 1201646-1201704 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAAAGACAUUGAGGUCUGUUGCUGUCCGGAGCCCUUUUUCUGUUGUACUACUGGCAAGUAUGAGUAGCAGUGCAAUAUUAAAAGGGCAUUGGCUGGCAGGCUAAGCUCCUCCUCCCUAC
Get precursor sequence
Structure
        10          20        30        40        50         
GAAAGACAUUGAGGUCUG--|     U    A        UC         A  GGCAAG 
                    UUGCUG CCGG GCCCUUUU  UGUUGUACU CU      \
                    GACGGU GGUU CGGGAAAA  AUAACGUGA GA      U
CAUCCCUCCUCCUCGAAUCG^     C    A        UU         C  UGAGUA 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-130-P3b_5p*

MirBase accessionNone
Sequence
0- GCCCUUUUUCUGUUGUACUACU -22
Get sequence
Mature sequence

Aca-Mir-130-P3b_3p

MirBase accessionMIMAT0021744
Sequence
37- CAGUGCAAUAUUAAAAGGGCAU -59
Get sequence