MirGeneDB

MirGeneDB ID

Aca-Mir-126-v2

Family name MIR-126 (all species)
Seed CGUACCG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-126
Paralogues Aca-Mir-126-v1  Aca-Mir-126-v3 
Orthologues Ami-Mir-126-v2  Bta-Mir-126-v2  Cfa-Mir-126-v2  Cin-Mir-126-v2  Cli-Mir-126-v2  Cpi-Mir-126-v2  Cpo-Mir-126-v2  Dno-Mir-126-v2  Ete-Mir-126-v2  Gga-Mir-126-v2  Hsa-Mir-126-v2  Mdo-Mir-126-v2  Mml-Mir-126-v2  Mmu-Mir-126-v2  Oan-Mir-126-v2  Ocu-Mir-126-v2  Rno-Mir-126-v2  Sha-Mir-126-v2  Sto-Mir-126-v2  Tgu-Mir-126-v2  Xtr-Mir-126-v2 
Node of Origin (locus) Olfactores
Node of Origin (family) Olfactores
Genome context
(anoCar2)
GL344924.1: 6937-6995 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-126-v2)
Mir-126-v1 GL344924.1: 6937-6995 [-] UCSC Ensembl
Mir-126-v2 GL344924.1: 6937-6995 [-] UCSC Ensembl
Mir-126-v3 GL344924.1: 6937-6995 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGAUGGACCCACUGCCGCUCCCCGCGGUCCAUUAUUACUUUUGGUACGCGCUGUGCCACUUCAAACUCGUACCGUGAGUAAUAAUGCGCUGAGGGACAGCACCCGCUGCAAACGCCGU
Get precursor sequence
Structure
        10         20         30        40        50         
GGGAUGGACCCACUGCC-   C-|  G    C           U       CGCUGUGCC 
                  GCU  CCC CGGU CAUUAUUACUU UGGUACG         \
                  CGA  GGG GUCG GUAAUAAUGAG GCCAUGC         A
UGCCGCAAACGUCGCCCA   CA^  A    C           U       UCAAACUUC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-126-v2_5p*

MirBase accessionMIMAT0021730
Sequence
0- CAUUAUUACUUUUGGUACGCGC -22
Get sequence
Mature sequence

Aca-Mir-126-v2_3p

MirBase accessionMIMAT0021731
Sequence
37- UCGUACCGUGAGUAAUAAUGCG -59
Get sequence