MirGeneDB

MirGeneDB ID

Aca-Mir-103-P3

Family name MIR-103 (all species)
Seed GCAGCAU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-107
Paralogues Aca-Mir-103-P1  Aca-Mir-103-P2 
Orthologues Bfl-Mir-103  Bta-Mir-103-P3  Cfa-Mir-103-P3  Cli-Mir-103-P3  Cpi-Mir-103-P3  Cpo-Mir-103-P3  Dno-Mir-103-P3  Dre-Mir-103-P3a  Dre-Mir-103-P3b  Ete-Mir-103-P3  Gga-Mir-103-P3  Hsa-Mir-103-P3  Mdo-Mir-103-P3  Mml-Mir-103-P3  Mmu-Mir-103-P3  Oan-Mir-103-P3  Ocu-Mir-103-P3  Pfl-Mir-103  Pmi-Mir-103  Rno-Mir-103-P3  Sha-Mir-103-P3  Sko-Mir-103  Spu-Mir-103  Sto-Mir-103-P3  Tgu-Mir-103-P3  Xtr-Mir-103-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Deuterostomia
Genome context
(anoCar2)
GL343219.1: 2879-2938 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CACUUCCAGGUCUUUCUUCUCUUUGCUUUCAGCUUCUUUACAGUGUUGCCUUGUGGCAUGGAGUUCAAGCAGCAUUGUACAGGGCUAUCAAAGCGCAGAGAGUCGACUUCAAUGAGCAAC
Get precursor sequence
Structure
        10          20        30          40        50         
CACUUCCAGGUCUUUCU--     U      C--|   U  U           C   UGGCA 
                   UCUCU UGCUUU   AGCU CU UACAGUGUUGC UUG     U
                   AGAGA GCGAAA   UCGG GA AUGUUACGACG AAC     G
CAACGAGUAACUUCAGCUG     C      CUA^   -  C           -   UUGAG 
.       110       100        90         80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-103-P3_5p*

MirBase accessionMIMAT0021713
Sequence
0- AGCUUCUUUACAGUGUUGCCUUG -23
Get sequence
Mature sequence

Aca-Mir-103-P3_3p

MirBase accessionMIMAT0021714
Sequence
37- AGCAGCAUUGUACAGGGCUAUCA -60
Get sequence