MirGeneDB

MirGeneDB ID

Aca-Mir-10-P1a-v1

Family name MIR-10 (all species)
Seed ACCCUGU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-10a
Paralogues Aca-Mir-10-P1a-v2  Aca-Mir-10-P1b-v1  Aca-Mir-10-P1b-v2  Aca-Mir-10-P1c-v1  Aca-Mir-10-P1c-v2  Aca-Mir-10-P2a  Aca-Mir-10-P2b  Aca-Mir-10-P2c  Aca-Mir-10-P3a  Aca-Mir-10-P3b  Aca-Mir-10-P3c 
Orthologues Aae-Mir-10-P1-v1  Aae-Mir-10-P1-v2  Ami-Mir-10-P1a-v1  Ami-Mir-10-P1a-v2  Asu-Mir-10-P1  Bfl-Mir-10-P1-v1  Bfl-Mir-10-P1-v2  Bge-Mir-10-P1-v1  Bge-Mir-10-P1-v2  Bta-Mir-10-P1a-v1  Bta-Mir-10-P1a-v2  Cbr-Mir-10-P1  Cel-Mir-10-P1  Cfa-Mir-10-P1a-v1  Cfa-Mir-10-P1a-v2  Cgi-Mir-10-P1  Cli-Mir-10-P1a-v1  Cli-Mir-10-P1a-v2  Cpi-Mir-10-P1a-v1  Cpi-Mir-10-P1a-v2  Cpo-Mir-10-P1a-v1  Cpo-Mir-10-P1a-v2  Cte-Mir-10-P1  Dan-Mir-10-P1  Dme-Mir-10-P1  Dmo-Mir-10-P1  Dno-Mir-10-P1a-v1  Dno-Mir-10-P1a-v2  Dpu-Mir-10-P1-v1  Dpu-Mir-10-P1-v2  Dre-Mir-10-P1a1-v1  Dre-Mir-10-P1a1-v2  Dre-Mir-10-P1a2-v1  Dre-Mir-10-P1a2-v2  Ete-Mir-10-P1a-v1  Ete-Mir-10-P1a-v2  Gga-Mir-10-P1a-v1  Gga-Mir-10-P1a-v2  Hme-Mir-10-P1-v1  Hme-Mir-10-P1-v2  Hsa-Mir-10-P1a-v1  Hsa-Mir-10-P1a-v2  Isc-Mir-10-P1-v1  Isc-Mir-10-P1-v2  Lgi-Mir-10-P1  Mdo-Mir-10-P1a-v1  Mdo-Mir-10-P1a-v2  Mml-Mir-10-P1a-v1  Mml-Mir-10-P1a-v2  Mmu-Mir-10-P1a-v1  Mmu-Mir-10-P1a-v2  Oan-Mir-10-P1a-v1  Oan-Mir-10-P1a-v2  Ocu-Mir-10-P1a-v1  Ocu-Mir-10-P1a-v2  Pfl-Mir-10-P1  Pmi-Mir-10-P1  Rno-Mir-10-P1a-v1  Rno-Mir-10-P1a-v2  Sha-Mir-10-P1a-v1  Sha-Mir-10-P1a-v2  Sko-Mir-10-P1  Spu-Mir-10-P1  Sto-Mir-10-P1a-v1  Sto-Mir-10-P1a-v2  Tca-Mir-10-P1-v1  Tca-Mir-10-P1-v2  Tgu-Mir-10-P1a-v1  Tgu-Mir-10-P1a-v2  Xtr-Mir-10-P1a-v1  Xtr-Mir-10-P1a-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Eumetazoa
Genome context
(anoCar2)
6: 75570727-75570788 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-10-P1a-v1)
Mir-10-P1a-v1 6: 75570727-75570788 [-] UCSC Ensembl
Mir-10-P1a-v2 6: 75570728-75570787 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGCAGAAUGUCUCUCUCUGUCUUCUGUAUGUACCCUGUAGAUCCGAAUUUGUGUAAAAGAAACUGCGUCACAAAUUCGCGUCUAGGGGAAUAUGUAGUAGACACAAACGCUACGGACCCGCA
Get precursor sequence
Structure
        10          20        30        40        50        60 
AGCAGAAUGUCUCUCUC--|    U        A    G     C         GUAAAAGA 
                   UGUCU CUGUAUGU CCCU UAGAU CGAAUUUGU        \
                   ACAGA GAUGUAUA GGGG AUCUG GCUUAAACA        A
ACGCCCAGGCAUCGCAAAC^    U        A    -     C         CUGCGUCA 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site +1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-10-P1a-v1_5p

MirBase accessionMIMAT0021717
Sequence
0- UACCCUGUAGAUCCGAAUUUGU -22
Get sequence
Star sequence

Aca-Mir-10-P1a-v1_3p*

MirBase accessionMIMAT0021718
Sequence
41- AAAUUCGCGUCUAGGGGAAUA -62
Get sequence