MirGeneDB

MirGeneDB ID

Aae-Mir-9-P9

Family name MIR-9 (all species)
Seed CUUUGGU
Species Yellow fever mosquito (Aedes aegypti)
MiRBase ID aae-mir-9c
Paralogues Aae-Mir-9-P7a  Aae-Mir-9-P7b  Aae-Mir-9-P8  Aae-Mir-9-P10-v1  Aae-Mir-9-P10-v2 
Orthologues Cin-Mir-9  Cte-Mir-9  Dan-Mir-9-P9  Dme-Mir-9-P9  Dmo-Mir-9-P9  Hme-Mir-9-o9  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) Diptera
Node of Origin (family) Bilateria
Genome context
(Aaeg_L3)
supercont1.785: 186231-186302 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GUAUCCGUAUCCGUAUGAUUUCCGGCUGAAUCUUUGGUAUUCUAGCUGUAGAAUGUUGAGCUUUGUGAUAUGGUAUCUUCUAAAGCUUUAGUACCAGAGGUCCAACUGGGAAUUGCUUGCUACCGCUGCUGC
Get precursor sequence
Structure
        10          20        30        40        50        60     
GUAUCCGUAUCCGUAUG--|       C  A            CU    G    AUGUUGAGCUUU 
                   AUUUCCGG UG AUCUUUGGUAUU  AGCU UAGA            G
                   UAAGGGUC AC UGGAGACCAUGA  UCGA AUCU            U
CGUCGUCGCCAUCGUUCGU^       A  C            UU    A    UCUAUGGUAUAG 
130       120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe To To To
Mature sequence

Aae-Mir-9-P9_5p

MirBase accessionMIMAT0014212
Sequence
0- UCUUUGGUAUUCUAGCUGUAGA -22
Get sequence
Star sequence

Aae-Mir-9-P9_3p*

MirBase accessionMIMAT0014213
Sequence
50- UAAAGCUUUAGUACCAGAGGUC -72
Get sequence