MirGeneDB

MirGeneDB ID

Aae-Mir-9-P7b

Family name MIR-9 (all species)
Seed CUUUGGU
Species Yellow fever mosquito (Aedes aegypti)
MiRBase ID aae-mir-9a-2
Paralogues Aae-Mir-9-P7a  Aae-Mir-9-P8  Aae-Mir-9-P9  Aae-Mir-9-P10-v1  Aae-Mir-9-P10-v2 
Orthologues Cin-Mir-9  Cte-Mir-9  Dan-Mir-9-P7  Dme-Mir-9-P7  Dmo-Mir-9-P7  Hme-Mir-9-o7  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) A. aegypti
Node of Origin (family) Bilateria
Genome context
(Aaeg_L3)
supercont1.517: 555117-555178 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UACUUACUUACCCAAUCGGUGUCAAAGUUCUCUUUGGUUAUCUAGCUGUAUGAGUGAAUUUAGAACAUCAUAAAGCUAGCAUACCGAAGUUAAUAGUUGACUACCAAUCAGCGUUGGAUGGU
Get precursor sequence
Structure
        10        20          30        40        50        60
UACUUACUUACCCAAUCG  -     A-|  CU       UAU      G     GUGAAU 
                  GU GUCAA  GUU  CUUUGGU   CUAGCU UAUGA      U
                  CA CAGUU  UAA  GAAGCCA   GAUCGA AUACU      U
UGGUAGGUUGCGACUAAC  U     GA^  UU       UAC      A     ACAAGA 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site -1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Fe Fe Fe Fe To To To
Mature sequence

Aae-Mir-9-P7b_5p

MirBase accessionMIMAT0014323
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Star sequence

Aae-Mir-9-P7b_3p*

MirBase accessionNone
Sequence
39- AUAAAGCUAGCAUACCGAAGUUA -62
Get sequence