MirGeneDB

MirGeneDB ID

Aae-Mir-9-P10-v1

Family name MIR-9 (all species)
Seed AAAGCUA
Species Yellow fever mosquito (Aedes aegypti)
MiRBase ID aae-mir-79
Paralogues Aae-Mir-9-P7a  Aae-Mir-9-P7b  Aae-Mir-9-P8  Aae-Mir-9-P9  Aae-Mir-9-P10-v2 
Orthologues Cin-Mir-9  Cte-Mir-9  Dan-Mir-9-P10-v1  Dan-Mir-9-P10-v2  Dme-Mir-9-P10-v1  Dme-Mir-9-P10-v2  Dmo-Mir-9-P10-v1  Dmo-Mir-9-P10-v2  Hme-Mir-9-o10  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) Diptera
Node of Origin (family) Bilateria
Genome context
(Aaeg_L3)
supercont1.785: 213277-213338 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-9-P10-v1)
Mir-306 supercont1.785: 213078-213173 [+] Ensembl
Mir-9-P10-v1 supercont1.785: 213277-213338 [+] Ensembl
Mir-9-P10-v2 supercont1.785: 213278-213337 [+] Ensembl
Mir-9-P8 supercont1.785: 213584-213649 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CAGAAUGAGAAAACGGAACCCAUCGUCCAUGCUUUGGCGCUUUAGCUGUAUGAUAGAAUUUAAUAUUUCAUAAAGCUAGAUUACCAAAGCAUGGAAGGCUUGGGCGGUGUCGUCCCUCUAAC
Get precursor sequence
Structure
        10        20          30        40        50        60
CAGAAUGAGAAAACGGAA    UCG--|           CGC       G    AUAGAAU 
                  CCCA     UCCAUGCUUUGG   UUUAGCU UAUG       U
                  GGGU     AGGUACGAAACC   AGAUCGA AUAC       U
CAAUCUCCCUGCUGUGGC    UCGGA^           AUU       A    UUUAUAA 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Fe Fe Fe Fe To To To
Star sequence

Aae-Mir-9-P10-v1_5p*

MirBase accessionMIMAT0014294
Sequence
0- GCUUUGGCGCUUUAGCUGUAUG -22
Get sequence
Mature sequence

Aae-Mir-9-P10-v1_3p

MirBase accessionMIMAT0014295
Sequence
40- UAAAGCUAGAUUACCAAAGCAU -62
Get sequence