MirGeneDB

MirGeneDB ID

Aae-Mir-2940

Family name MIR-2940 (all species)
Seed GUCGACA
Species Yellow fever mosquito (Aedes aegypti)
MiRBase ID aae-mir-2940
Paralogues
Orthologues
Node of Origin (locus) A. aegypti
Node of Origin (family) A. aegypti
Genome context
(Aaeg_L3)
supercont1.222: 643960-644064 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UGGUGCGAUUGCAGCAGAUCUUGGAGACAUUGGUUUAUCUUAUCUGUCGAGGCAAGUUAUUUUACCGGAUAGUGUUUCUUUUCGUGAGCAAUCACCACUAUCCAGCUCUUCUUGUCGACAGGGAGAUAAAUCACUGACAUCCGAUGGUCAUUCAUCGAAGGUGGC
Get precursor sequence
Structure
        10        20          30        40        50        60        70        80  
UGGUGCGAUUGCAGCAGAUC-     GA-| U           A        GGCAAGUUAUUUUACCGGAUAGUGUUUCUUU 
                     UUGGA   CA UGGUUUAUCUU UCUGUCGA                               U
                     AGCCU   GU ACUAAAUAGAG GGACAGCU                               C
CGGUGGAAGCUACUUACUGGU     ACA^ C           -        GUUCUUCUCGACCUAUCACCACUAACGAGUG 
   160       150       140       130        120       110       100        90
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe To To To
Star sequence

Aae-Mir-2940_5p*

MirBase accessionMIMAT0014283
Sequence
0- UGGUUUAUCUUAUCUGUCGAGGC -23
Get sequence
Mature sequence

Aae-Mir-2940_3p

MirBase accessionMIMAT0014284
Sequence
82- UGUCGACAGGGAGAUAAAUCACU -105
Get sequence