MirGeneDB

Gene name

Xtr-Mir-29-P1b

Family name MIR-29 (all species)
Species Tropical clawed frog (Xenopus tropicalis)
MiRBase ID xtr-mir-29c
Paralogues Xtr-Mir-29-P1a  Xtr-Mir-29-P2a  Xtr-Mir-29-P2b 
Orthologues Aca-Mir-29-P1b  Ami-Mir-29-P1b  Asu-Mir-29-P1  Bfl-Mir-29-P1  Bta-Mir-29-P1b  Cbr-Mir-29-P1  Cel-Mir-29-P1  Cfa-Mir-29-P1b3  Cfa-Mir-29-P1b4  Cgi-Mir-29-P1  Cin-Mir-29-P1  Cli-Mir-29-P1b  Cpi-Mir-29-P1b  Cpo-Mir-29-P1b  Cte-Mir-29-P1  Dno-Mir-29-P1b  Ete-Mir-29-P1b  Gga-Mir-29-P1b  Hsa-Mir-29-P1b  Isc-Mir-29-P1  Lgi-Mir-29-P1  Mdo-Mir-29-P1b  Mml-Mir-29-P1b  Mmu-Mir-29-P1b  Oan-Mir-29-P1b  Ocu-Mir-29-P1b  Pfl-Mir-29-P1  Pmi-Mir-29-P1  Rno-Mir-29-P1b1  Rno-Mir-29-P1b2  Sha-Mir-29-P1b  Sko-Mir-29-P1  Spu-Mir-29-P1  Sto-Mir-29-P1b  Tgu-Mir-29-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(xenTro7)
KB021649: 81832318-81832378 [+] UCSC
Clustered MiRNAs
(< 10kb from Mir-29-P1b)
Mir-29-P2b KB021649: 81829177-81829240 [+] UCSC
Precursor
(pre-Mir +30nt flank)
UAAUAGAACAACAGUCCCUUACACAGGAUGACCGAUCUCUCUUGGUGUUCAGAGGCUCAGGUCUUCAUCUAGCACCAUUUGAAAUCGGUUAUAAUGUAAGGUGAAUGGCAACAAAGCUGCA
Get precursor sequence
Structure
        10            20        30        40        50        60
UAAUAGAACAACAGUCC----|     CAGG         C  UCU       C   GGCUCA 
                     CUUACA    AUGACCGAU UC   UGGUGUU AGA      G
                     GAAUGU    UAUUGGCUA AG   ACCACGA UCU      G
ACGUCGAAACAACGGUAAGUG^     AA--         A  UUU       -   ACUUCU 
 .       110       100          90        80         70
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site -2 on the 5p arm relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Em Em Em Em He
Star sequence

Xtr-Mir-29-P1b_5p*

MirBase accessionMIMAT0003676
Sequence
0- ACCGAUCUCUCUUGGUGUUCAGA -23
Get sequence
Validated targets TargetScanVert: xtr-miR-29c-5p
Mature sequence

Xtr-Mir-29-P1b_3p

MirBase accessionMIMAT0003677
Sequence
39- UAGCACCAUUUGAAAUCGGUUA -61
Get sequence
Seed sequenceAGCACCA
Validated targets TargetScanVert: xtr-miR-29c-3p