MirGeneDB

Gene name

Xtr-Mir-216-P1a

Family name MIR-216 (all species)
MiRBase ID xtr-mir-216
Paralogues
Orthologues Aca-Mir-216-P1a  Ami-Mir-216-P1a  Asu-Mir-216-P1  Bfl-Mir-216-P1  Bta-Mir-216-P1a  Cel-Mir-216-P1  Cfa-Mir-216-P1a  Cgi-Mir-216-P1  Cli-Mir-216-P1a  Cpi-Mir-216-P1a  Cpo-Mir-216-P1a  Dme-Mir-216-P1  Dno-Mir-216-P1a  Dpu-Mir-216-P1  Dre-Mir-216-P1a  Efe-Mir-216-P1  Ete-Mir-216-P1a  Gga-Mir-216-P1a  Hsa-Mir-216-P1a  Isc-Mir-216-P1  Lgi-Mir-216-P1  Mdo-Mir-216-P1a  Mml-Mir-216-P1a  Mmu-Mir-216-P1a  Ocu-Mir-216-P1a  Rno-Mir-216-P1a  Sha-Mir-216-P1a  Tca-Mir-216-P1 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(xenTro7)
KB021654: 91591631-91591692 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-216-P1a)
Mir-217-v2 KB021654: 91591265-91591325 [-] UCSC
Mir-217-v1 KB021654: 91591266-91591324 [-] UCSC
Precursor
(pre-Mir +30nt flank)
ACGGCUAAGCUAAAUGGCUGUGAAUUGGCUUAAUCUCAGCUGGCAACUGUGAGCAGUUAAUAAAUUAUCUCACAGUGGUCUCUGGGAUUAUACUAAACACAGCAAUUCUCUUGCUUUAUGGA
Get precursor sequence
Structure
        10           20        30        40        50        60 
ACGGCUAAGCUAAAUGG---|    AA    CU         CU   A        CAGUUAA 
                    CUGUG  UUGG  UAAUCUCAG  GGC ACUGUGAG       \
                    GACAC  AAUC  AUUAGGGUC  CUG UGACACUC       U
AGGUAUUUCGUUCUCUUAAC^    A-    AU         U-   G        UAUUAAA 
120       110       100         90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br He
Mature sequence

Xtr-Mir-216-P1a_5p

MirBase accessionMIMAT0003629
Sequence
0- UAAUCUCAGCUGGCAACUGUGAG -23
Get sequence
Seed sequenceAAUCUCA
Validated targets TargetScanVert: xtr-miR-216
Star sequence

Xtr-Mir-216-P1a_3p*

MirBase accessionNone
Sequence
40- CACAGUGGUCUCUGGGAUUAUA -62
Get sequence