MirGeneDB

MirGeneDB ID

Xtr-Mir-199-P2

Family name MIR-199 (all species)
Seed CCAGUGU
Species Tropical clawed frog (Xenopus tropicalis)
MiRBase ID xtr-mir-199b
Paralogues Xtr-Mir-199-P3-v1  Xtr-Mir-199-P3-v2  Xtr-Mir-199-P3-v3 
Orthologues Aca-Mir-199-P2-v1  Aca-Mir-199-P2-v2  Aca-Mir-199-P2-v3  Ami-Mir-199-P2-v1  Ami-Mir-199-P2-v2  Ami-Mir-199-P2-v3  Bta-Mir-199-P2-v1  Bta-Mir-199-P2-v2  Bta-Mir-199-P2-v3  Cfa-Mir-199-P2-v1  Cfa-Mir-199-P2-v2  Cfa-Mir-199-P2-v3  Cpi-Mir-199-P2-v1  Cpi-Mir-199-P2-v2  Cpi-Mir-199-P2-v3  Cpo-Mir-199-P2-v1  Cpo-Mir-199-P2-v2  Cpo-Mir-199-P2-v3  Dre-Mir-199-P2-v1  Dre-Mir-199-P2-v2  Dre-Mir-199-P2-v3  Ete-Mir-199-P2-v1  Ete-Mir-199-P2-v2  Ete-Mir-199-P2-v3  Hsa-Mir-199-P2-v1  Hsa-Mir-199-P2-v2  Hsa-Mir-199-P2-v3  Mdo-Mir-199-P2-v1  Mdo-Mir-199-P2-v2  Mdo-Mir-199-P2-v3  Mml-Mir-199-P2-v1  Mml-Mir-199-P2-v2  Mml-Mir-199-P2-v3  Mmu-Mir-199-P2-v1  Mmu-Mir-199-P2-v2  Mmu-Mir-199-P2-v3  Ocu-Mir-199-P2-v1  Ocu-Mir-199-P2-v2  Ocu-Mir-199-P2-v3  Sha-Mir-199-P2-v1  Sha-Mir-199-P2-v2  Sha-Mir-199-P2-v3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(xenTro7)
KB021670: 879314-879374 [-] UCSC
Precursor
(pre-Mir +30nt flank)
AAGAUCCCGAGAGGUGGGUGGUCCCGUUCCCCCAGUGUUCAGACUACGUGUUCGUUGGACAGAACCUGAACAGUAGUCUACACACUGGUUAAACUGGGCCAUGCGGUCAACUGCUGCACAU
Get precursor sequence
Structure
        10          20        30        40        50        60
AAGAUCCCGAGAGGUGG--|      C   CCC       UC       G     GUUGGA 
                   GUGGUCC GUU   CCAGUGU  AGACUAC UGUUC      C
                   UACCGGG CAA   GGUCACA  UCUGAUG ACAAG      A
UACACGUCGUCAACUGGCG^      U   AUU       CA       -     UCCAAG 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
CommentXenopus is arm-shifted relative to all other vertebrates and does not show the conserved set of processing variants.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Em Em Em Em He
Mature sequence

Xtr-Mir-199-P2_5p

MirBase accessionMIMAT0003692
Sequence
0- CCCAGUGUUCAGACUACGUGUUC -23
Get sequence
Validated targets TargetScanVert: xtr-miR-199b
Star sequence

Xtr-Mir-199-P2_3p*

MirBase accessionNone
Sequence
39- ACAGUAGUCUACACACUGGUUA -61
Get sequence