MirGeneDB

Gene name

Tgu-Mir-9-P2

Family name MIR-9 (all species)
MiRBase ID tgu-mir-9-2
Paralogues Tgu-Mir-9-P3 
Orthologues Aca-Mir-9-P2  Ami-Mir-9-P2  Bta-Mir-9-P2  Cfa-Mir-9-P2  Cin-Mir-9  Cli-Mir-9-P2  Cpi-Mir-9-P2  Cpo-Mir-9-P2  Cte-Mir-9  Dno-Mir-9-P2  Dre-Mir-9-o2  Dre-Mir-9-P2a  Dre-Mir-9-P2b  Ete-Mir-9-P2  Gga-Mir-9-P2  Hsa-Mir-9-P2  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P2  Mml-Mir-9-P2  Mmu-Mir-9-P2  Ocu-Mir-9-P2  Pmi-Mir-9  Rno-Mir-9-P2  Sha-Mir-9-P2  Spu-Mir-9  Xtr-Mir-9-P2 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(taeGut3.2.4)
Z: 12103947-12104005 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
NNNNNNNCCUCUGAGGGAAGCGAGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGUUUUGGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAACUCCUUCAAGAUCAUCGUACAGCGU
Get precursor sequence
Structure
        10          20        30        40        50         
NNNNNNNCCUCUGAGGG--|  C     G   UC               G     GUGUU 
                   AAG GAGUU UUA  UUUGGUUAUCUAGCU UAUGA     U
                   UUC CUCAA AAU  AAGCCAAUAGAUCGA AUACU     U
UGCGACAUGCUACUAGAAC^  -     A   GA               A     UCUGG 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Mature sequence

Tgu-Mir-9-P2_5p

MirBase accessionMIMAT0014502
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Seed sequenceCUUUGGU
Star sequence

Tgu-Mir-9-P2_3p*

MirBase accessionMIMAT0014627
Sequence
37- AUAAAGCUAGAUAACCGAAAGU -59
Get sequence