MirGeneDB

Gene name

Tgu-Mir-2984

Family name MIR-2984 (all species)
MiRBase ID tgu-mir-2984
Paralogues
Orthologues Cli-Mir-2984  Gga-Mir-2984 
Node of Origin (gene) Neognathae
Node of Origin (family) Neognathae
Genome context
(taeGut3.2.4)
1: 39743256-39743322 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GACUCCCACAAUGAAAUGCUUCACCUGCGGAGCCUGCUGAGAGUGAAAUUGAUAAAGGACAGCACCAGCCCAGGCAAUUUCACUCACAGCGGGCACUUGCAGGUGAAGCACUACCAUAAAAUGGAGC
Get precursor sequence
Structure
        10         20         30        40        50        60   
GACUCCCACAAUGAAAU-           -| A        A           AUAAAGGACAG 
                  GCUUCACCUGC GG GCCUGCUG GAGUGAAAUUG           \
                  CGAAGUGGACG UC CGGGCGAC CUCACUUUAAC           C
CGAGGUAAAAUACCAUCA           U^ A        A           GGACCCGACCA 
     120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Mature sequence

Tgu-Mir-2984_5p

MirBase accessionMIMAT0014494
Sequence
0- AGCCUGCUGAGAGUGAAAUUGA -22
Get sequence
Seed sequenceGCCUGCU
Star sequence

Tgu-Mir-2984_3p*

MirBase accessionMIMAT0026970
Sequence
45- AAUUUCACUCACAGCGGGCACU -67
Get sequence