MirGeneDB

Gene name

Tgu-Mir-29-P2a

Family name MIR-29 (all species)
Species Zebra finch (Taeniopygia guttata)
MiRBase ID tgu-mir-29b-1
Paralogues Tgu-Mir-29-P1a  Tgu-Mir-29-P1b  Tgu-Mir-29-P2b-v1  Tgu-Mir-29-P2b-v2 
Orthologues Aae-Mir-29-P2  Aca-Mir-29-P2a  Ami-Mir-29-P2a-v1  Ami-Mir-29-P2a-v2  Asu-Mir-29-P2  Bfl-Mir-29-P2  Bta-Mir-29-P2a  Cbr-Mir-29-P2  Cel-Mir-29-P2  Cfa-Mir-29-P2a  Cgi-Mir-29-P2  Cli-Mir-29-P2a  Cpi-Mir-29-P2a  Cpo-Mir-29-P2a  Cte-Mir-29-P2  Dan-Mir-29-P2  Dme-Mir-29-P2  Dmo-Mir-29-P2  Dno-Mir-29-P2a  Dre-Mir-29-P2a  Ete-Mir-29-P2a  Gga-Mir-29-P2a  Hme-Mir-29-P2  Hsa-Mir-29-P2a  Mdo-Mir-29-P2a  Mml-Mir-29-P2a  Mmu-Mir-29-P2a  Oan-Mir-29-P2a  Ocu-Mir-29-P2a  Pfl-Mir-29-P2  Pmi-Mir-29-P2  Rno-Mir-29-P2a  Sha-Mir-29-P2a  Sko-Mir-29-P2  Spu-Mir-29-P2  Sto-Mir-29-P2a  Tca-Mir-29-P2  Xtr-Mir-29-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(taeGut3.2.4)
1A: 2715203-2715266 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-29-P2a)
Mir-29-P1a 1A: 2716220-2716279 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUCCCAGCUAGACUCAAGCUCCCUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAACUAUUCAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGAGGAAGAAUGCCUGCCUUCAUCAGG
Get precursor sequence
Structure
        10          20        30         40        50        60  
CUCCCAGCUAGACUCAAGC--   CU      -|         U      GU     UUUAACU 
                     UCC  CAGGAA GCUGGUUUCA AUGGUG  UUAGA       \
                     AGG  GUUCUU UGACUAAAGU UACCAC  GAUCU       A
GGACUACUUCCGUCCGUAAGA   AG      G^         U      --     GUUACUU 
  120       110       100        90        80          70
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha cut +1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Star sequence

Tgu-Mir-29-P2a_5p*

MirBase accessionMIMAT0031064
Sequence
0- GCUGGUUUCAUAUGGUGGUUUAGA -24
Get sequence
Mature sequence

Tgu-Mir-29-P2a_3p

MirBase accessionMIMAT0014601
Sequence
41- UAGCACCAUUUGAAAUCAGUGUU -64
Get sequence
Seed sequenceAGCACCA