MirGeneDB

Gene name

Tgu-Mir-29-P1a

Family name MIR-29 (all species)
Species Zebra finch (Taeniopygia guttata)
MiRBase ID tgu-mir-29a-1
Paralogues Tgu-Mir-29-P1b  Tgu-Mir-29-P2a  Tgu-Mir-29-P2b-v1  Tgu-Mir-29-P2b-v2 
Orthologues Aca-Mir-29-P1a  Ami-Mir-29-P1a  Asu-Mir-29-P1  Bfl-Mir-29-P1  Bta-Mir-29-P1a  Cbr-Mir-29-P1  Cel-Mir-29-P1  Cfa-Mir-29-P1a  Cgi-Mir-29-P1  Cin-Mir-29-P1  Cli-Mir-29-P1a  Cpi-Mir-29-P1a  Cpo-Mir-29-P1a  Cte-Mir-29-P1  Dno-Mir-29-P1a  Dre-Mir-29-P1a1  Ete-Mir-29-P1a  Gga-Mir-29-P1a  Hsa-Mir-29-P1a  Isc-Mir-29-P1  Lgi-Mir-29-P1  Mdo-Mir-29-P1a  Mml-Mir-29-P1a  Mmu-Mir-29-P1a  Oan-Mir-29-P1a  Ocu-Mir-29-P1a  Pfl-Mir-29-P1  Pmi-Mir-29-P1  Rno-Mir-29-P1a  Sha-Mir-29-P1a  Sko-Mir-29-P1  Spu-Mir-29-P1  Sto-Mir-29-P1a  Xtr-Mir-29-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(taeGut3.2.4)
1A: 2716220-2716279 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-29-P1a)
Mir-29-P2a 1A: 2715203-2715266 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGCAGAUCUCCGUAACCCCUUUAGAGGAUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAAUAAUUUCUAGCACCAUUUGAAAUCGGUUAUAGUGAUUGGGGAAUUGCACCUUGUGAAUU
Get precursor sequence
Structure
        10          20        30        40        50          
UGCAGAUCUCCGUAACC--|  UUAGAGG            UUU       C   GUCAAU 
                   CCU       AUGACUGAUUUC   UGGUGUU AGA      \
                   GGG       UAUUGGCUAAAG   ACCACGA UCU      A
UUAAGUGUUCCACGUUAAG^  UUAGUGA            UUU       -   UUAAUA 
.       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Star sequence

Tgu-Mir-29-P1a_5p*

MirBase accessionMIMAT0026990
Sequence
0- ACUGAUUUCUUUUGGUGUUCAGA -23
Get sequence
Mature sequence

Tgu-Mir-29-P1a_3p

MirBase accessionMIMAT0014532
Sequence
38- UAGCACCAUUUGAAAUCGGUUA -60
Get sequence
Seed sequenceAGCACCA