MirGeneDB

Gene name

Tgu-Mir-26-P1d

Family name MIR-26 (all species)
MiRBase ID tgu-mir-26-2
Paralogues Tgu-Mir-26-P1c 
Orthologues Aca-Mir-26-P1  Ami-Mir-26-P1  Bta-Mir-26-P1  Cfa-Mir-26-P1  Cli-Mir-26-P1  Cpi-Mir-26-P1  Cpo-Mir-26-P1  Dno-Mir-26-P1  Ete-Mir-26-P1  Gga-Mir-26-P1  Hsa-Mir-26-P1  Mdo-Mir-26-P1  Mml-Mir-26-P1  Mmu-Mir-26-P1  Rno-Mir-26-P1  Sha-Mir-26-P1  Xtr-Mir-26-P1 
Node of Origin (gene) T. guttata
Node of Origin (family) Vertebrata
Genome context
(taeGut3.2.4)
2: 4696545-4696605 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGGAUUUUCUUGCAGGAGGCUGUGGCCUGGUUCAAGUAAUCCAGGAUAGGCUGUAUCCAUUCUAACUCGCCUAUUCUUGGUUACUUGCACUGGGACAGGGCCACAACUGUGUGACCCAGGA
Get precursor sequence
Structure
        10          20        30        40        50          
UGGAUUUUCUUGCAGGA--|   G  G  UG  U         C         UGUAUCCA 
                   GGCU UG CC  GU CAAGUAAUC AGGAUAGGC        \
                   CCGG AC GG  CA GUUCAUUGG UCUUAUCCG        U
AGGACCCAGUGUGUCAACA^   G  A  GU  C         U         CUCAAUCU 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Mature sequence

Tgu-Mir-26-P1d_5p

MirBase accessionMIMAT0014516
Sequence
0- UUCAAGUAAUCCAGGAUAGGCU -22
Get sequence
Seed sequenceUCAAGUA
Star sequence

Tgu-Mir-26-P1d_3p*

MirBase accessionMIMAT0026980
Sequence
39- CCUAUUCUUGGUUACUUGCACU -61
Get sequence