MirGeneDB

Gene name

Tgu-Mir-218-P1

Family name MIR-218 (all species)
MiRBase ID tgu-mir-218-1
Paralogues Tgu-Mir-218-P2 
Orthologues Aca-Mir-218-P1  Ami-Mir-218-P1  Bta-Mir-218-P1  Cfa-Mir-218-P1  Cli-Mir-218-P1  Cpi-Mir-218-P1  Cpo-Mir-218-P1  Dno-Mir-218-P1  Dre-Mir-218-P1  Ete-Mir-218-P1  Gga-Mir-218-P1  Hsa-Mir-218-P1  Mdo-Mir-218-P1  Mml-Mir-218-P1  Mmu-Mir-218-P1  Ocu-Mir-218-P1  Rno-Mir-218-P1  Sha-Mir-218-P1  Xtr-Mir-218-P1 
Node of Origin (gene) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(taeGut3.2.4)
4: 54394652-54394715 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCAGUUUUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGUGAGGUAUGAGUAAAACAUGGUUCUGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACAGCAUGGCA
Get precursor sequence
Structure
        10          20        30        40        50        60 
GCAGUUUUGAUAAUGUA--|  A   U      U         CU        GGUUGUGAG 
                   GCG GAU UUCUGU GUGCUUGAU  AACCAUGU         G
                   CGC CUG AAGGUA CACGAACUG  UUGGUACA         U
ACGGUACGACAUCUUUCGA^  A   C      C         UC        AAAUGAGUA 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer cut +1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Mature sequence

Tgu-Mir-218-P1_5p

MirBase accessionMIMAT0014522
Sequence
0- UUGUGCUUGAUCUAACCAUGU -21
Get sequence
Seed sequenceUGUGCUU
Star sequence

Tgu-Mir-218-P1_3p*

MirBase accessionMIMAT0026984
Sequence
43- AUGGUUCUGUCAAGCACCAUG -64
Get sequence