MirGeneDB

Gene name

Tgu-Mir-199-P3-v3

Family name MIR-199 (all species)
MiRBase ID tgu-mir-199-1
Paralogues Tgu-Mir-199-P2-v1  Tgu-Mir-199-P2-v2  Tgu-Mir-199-P2-v3  Tgu-Mir-199-P3-v1  Tgu-Mir-199-P3-v2 
Orthologues Aca-Mir-199-P3-v1  Aca-Mir-199-P3-v2  Aca-Mir-199-P3-v3  Ami-Mir-199-P3-v1  Ami-Mir-199-P3-v2  Ami-Mir-199-P3-v3  Bta-Mir-199-P3-v1  Bta-Mir-199-P3-v2  Bta-Mir-199-P3-v3  Cfa-Mir-199-P3-v1  Cfa-Mir-199-P3-v2  Cfa-Mir-199-P3-v3  Cli-Mir-199-P3-v1  Cli-Mir-199-P3-v2  Cli-Mir-199-P3-v3  Cpi-Mir-199-P3-v1  Cpi-Mir-199-P3-v2  Cpi-Mir-199-P3-v3  Cpo-Mir-199-P3-v1  Cpo-Mir-199-P3-v2  Cpo-Mir-199-P3-v3  Dno-Mir-199-P3-v1  Dno-Mir-199-P3-v2  Dno-Mir-199-P3-v3  Dre-Mir-199-P3-v1  Dre-Mir-199-P3-v2  Dre-Mir-199-P3-v3  Ete-Mir-199-P3-v1  Ete-Mir-199-P3-v2  Ete-Mir-199-P3-v3  Gga-Mir-199-P3-v1  Gga-Mir-199-P3-v2  Gga-Mir-199-P3-v3  Hsa-Mir-199-P3-v1  Hsa-Mir-199-P3-v2  Hsa-Mir-199-P3-v3  Mdo-Mir-199-P3-v1  Mdo-Mir-199-P3-v2  Mdo-Mir-199-P3-v3  Mml-Mir-199-P3-v1  Mml-Mir-199-P3-v2  Mml-Mir-199-P3-v3  Mmu-Mir-199-P3-v1  Mmu-Mir-199-P3-v2  Mmu-Mir-199-P3-v3  Ocu-Mir-199-P3-v1  Ocu-Mir-199-P3-v2  Ocu-Mir-199-P3-v3  Rno-Mir-199-P3-v1  Rno-Mir-199-P3-v2  Rno-Mir-199-P3-v3  Sha-Mir-199-P3-v1  Sha-Mir-199-P3-v2  Sha-Mir-199-P3-v3 
Node of Origin (gene) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(taeGut3.2.4)
17: 5549806-5549866 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-199-P3-v3)
Mir-199-P3-v1 17: 5549806-5549866 [+] UCSC Ensembl
Mir-199-P3-v2 17: 5549806-5549866 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGCAGAUCACAGAGGCUCCACUCCGUCUGCCCAGUGUUCAGACUACCUGUUCAGGACUACGAGAUUGUACAGUAGUCUGCACAUUGGUUAGGCUGUGCUGGGAUACACCACACACUGCCA
Get precursor sequence
Structure
        10         20         30        40        50        60
GAGCAGAUCACAGAGGC-    CUCC-|    C       U        C   U AGGACU 
                  UCCA     GUCUG CCAGUGU CAGACUAC UGU C      A
                  GGGU     CGGAU GGUUACA GUCUGAUG ACA G      C
ACCGUCACACACCACAUA    CGUGU^    U       C        -   U UUAGAG 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Star sequence

Tgu-Mir-199-P3-v3_5p*

MirBase accessionMIMAT0014645
Sequence
0- CCCAGUGUUCAGACUACCUGUUC -23
Get sequence
Mature sequence

Tgu-Mir-199-P3-v3_3p

MirBase accessionMIMAT0014617
Sequence
40- CAGUAGUCUGCACAUUGGUUA -61
Get sequence
Seed sequenceAGUAGUC