MirGeneDB

MirGeneDB ID

Tgu-Mir-1467-P2

Family name MIR-1467 (all species)
Seed UCACACC
Species Zebra finch (Taeniopygia guttata)
MiRBase ID tgu-mir-1467-2
Paralogues Tgu-Mir-1467-P1 
Orthologues Cli-Mir-1467  Gga-Mir-1467-P2 
Node of Origin (locus) Neognathae
Node of Origin (family) Neognathae
Genome context
(taeGut3.2.4)
2: 142442515-142442579 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAGAAGGAAAACUGACAGGGCAGGUUUUUUUCUCAGCUACAUCGGUGUAAAUCCAGAGCAACUCCACUGAGAUUCACACCAGAGUAACUGAGAGCAGAAUCUGGCCAACAUCAUCCACCUGACCU
Get precursor sequence
Structure
        10          20        30        40         50        60  
AAGAAGGAAAACUGACA--| G        U       C   A  -     A    CAGAGCAA 
                   GG CAGGUUUU UUCUCAG UAC UC GGUGU AAUC        \
                   CC GUCUAAGA GAGAGUC AUG AG CCACA UUAG        C
UCCAGUCCACCUACUACAA^ G        C       A   -  A     C    AGUCACCU 
   120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Star sequence

Tgu-Mir-1467-P2_5p*

MirBase accessionMIMAT0025399
Sequence
0- UCUCAGCUACAUCGGUGUAAAUC -23
Get sequence
Mature sequence

Tgu-Mir-1467-P2_3p

MirBase accessionMIMAT0027342
Sequence
42- UUCACACCAGAGUAACUGAGAGC -65
Get sequence