
Gene name


Family name MIR-130 (all species)
MiRBase ID tgu-mir-130c
Paralogues Tgu-Mir-130-P1b  Tgu-Mir-130-P2a  Tgu-Mir-130-P2b  Tgu-Mir-130-P3b  Tgu-Mir-130-P4b 
Orthologues Aca-Mir-130-P3a  Ami-Mir-130-P3a  Cli-Mir-130-P3a  Cpi-Mir-130-P3a  Dre-Mir-130-P3a1  Gga-Mir-130-P3a  Mdo-Mir-130-P3a  Sha-Mir-130-P3a  Xtr-Mir-130-P3a 
Node of Origin (gene) Vertebrata
Node of Origin (family) Vertebrata
Genome context
19: 8784994-8785056 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-130-P3a)
Mir-130-P2a 19: 8783998-8784059 [-] UCSC Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10           20        30        40        50        60 
UCCUCUGUCCCUGAGUGG---| U   U             U          A  GGUGAUGA 
                     UG CUG CCAGUGCCCUUUU AUGUUGUACU CU        \
                     AC GAC GGUUACGGGAAAA UGUAACGUGA GA        U
UGUCUUGUUACGUCUAACAUA^ -   C             U          C  AAAACACG 
 120       110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
Fe Fe Fe Fe Ma Ma Ma Ma
Star sequence


MirBase accessionMIMAT0027012
Get sequence
Mature sequence


MirBase accessionMIMAT0014581
Get sequence
Seed sequenceAGUGCAA