MirGeneDB

MirGeneDB ID

Tgu-Mir-126-v2

Family name MIR-126 (all species)
Seed CGUACCG
Species Zebra finch (Taeniopygia guttata)
MiRBase ID tgu-mir-126
Paralogues Tgu-Mir-126-v1  Tgu-Mir-126-v3 
Orthologues Aca-Mir-126-v2  Ami-Mir-126-v2  Bta-Mir-126-v2  Cfa-Mir-126-v2  Cin-Mir-126-v2  Cli-Mir-126-v2  Cpi-Mir-126-v2  Cpo-Mir-126-v2  Dno-Mir-126-v2  Ete-Mir-126-v2  Gga-Mir-126-v2  Hsa-Mir-126-v2  Mdo-Mir-126-v2  Mml-Mir-126-v2  Mmu-Mir-126-v2  Oan-Mir-126-v2  Ocu-Mir-126-v2  Rno-Mir-126-v2  Sha-Mir-126-v2  Sto-Mir-126-v2  Xtr-Mir-126-v2 
Node of Origin (locus) Olfactores
Node of Origin (family) Olfactores
Genome context
(taeGut3.2.4)
17: 8833559-8833617 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-126-v2)
Mir-126-v1 17: 8833559-8833617 [-] UCSC Ensembl
Mir-126-v2 17: 8833559-8833617 [-] UCSC Ensembl
Mir-126-v3 17: 8833559-8833617 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGGAGCGGCGGGCGCCGCUGGUGACGGCCCAUUAUUACUUUUGGUACGCGCUGUGACACUUCAAACUCGUACCGUGAGUAAUAAUGCGCUGUGGCCAGCACGGGCAUCACGCAGCAAA
Get precursor sequence
Structure
        10          20        30        40        50         
GAGGAGCGGCGGGCGCC--|     G     C           U       CGCUGUGAC 
                   GCUGGU ACGGC CAUUAUUACUU UGGUACG         \
                   CGACCG UGUCG GUAAUAAUGAG GCCAUGC         A
AAACGACGCACUACGGGCA^     G     C           U       UCAAACUUC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Star sequence

Tgu-Mir-126-v2_5p*

MirBase accessionMIMAT0014639
Sequence
0- CAUUAUUACUUUUGGUACGCGC -22
Get sequence
Mature sequence

Tgu-Mir-126-v2_3p

MirBase accessionMIMAT0014544
Sequence
37- UCGUACCGUGAGUAAUAAUGCG -59
Get sequence