MirGeneDB

Gene name

Tgu-Mir-126-v1

Family name MIR-126 (all species)
Species Zebra finch (Taeniopygia guttata)
MiRBase ID tgu-mir-126
Paralogues Tgu-Mir-126-v2  Tgu-Mir-126-v3 
Orthologues Aca-Mir-126-v1  Ami-Mir-126-v1  Bta-Mir-126-v1  Cfa-Mir-126-v1  Cin-Mir-126-v1  Cli-Mir-126-v1  Cpi-Mir-126-v1  Cpo-Mir-126-v1  Dno-Mir-126-v1  Ete-Mir-126-v1  Gga-Mir-126-v1  Hsa-Mir-126-v1  Mdo-Mir-126-v1  Mml-Mir-126-v1  Mmu-Mir-126-v1  Oan-Mir-126-v1  Ocu-Mir-126-v1  Rno-Mir-126-v1  Sha-Mir-126-v1  Sto-Mir-126-v1  Xtr-Mir-126-v1 
Node of Origin (locus) Olfactores
Node of Origin (family) Olfactores
Genome context
(taeGut3.2.4)
17: 8833559-8833617 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-126-v1)
Mir-126-v2 17: 8833559-8833617 [-] UCSC Ensembl
Mir-126-v3 17: 8833559-8833617 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGGAGCGGCGGGCGCCGCUGGUGACGGCCCAUUAUUACUUUUGGUACGCGCUGUGACACUUCAAACUCGUACCGUGAGUAAUAAUGCGCUGUGGCCAGCACGGGCAUCACGCAGCAAA
Get precursor sequence
Structure
        10          20        30        40        50         
GAGGAGCGGCGGGCGCC--|     G     C           U       CGCUGUGAC 
                   GCUGGU ACGGC CAUUAUUACUU UGGUACG         \
                   CGACCG UGUCG GUAAUAAUGAG GCCAUGC         A
AAACGACGCACUACGGGCA^     G     C           U       UCAAACUUC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Mature sequence

Tgu-Mir-126-v1_5p

MirBase accessionMIMAT0014639
Sequence
0- CAUUAUUACUUUUGGUACGCG -21
Get sequence
Seed sequenceAUUAUUA
Star sequence

Tgu-Mir-126-v1_3p*

MirBase accessionMIMAT0014544
Sequence
38- CGUACCGUGAGUAAUAAUGCG -59
Get sequence