MirGeneDB

Gene name

Tgu-Mir-10-P1a-v1

Family name MIR-10 (all species)
MiRBase ID tgu-mir-10a
Paralogues Tgu-Mir-10-P1a-v2  Tgu-Mir-10-P1b-v1  Tgu-Mir-10-P1b-v2  Tgu-Mir-10-P2a3  Tgu-Mir-10-P2a4  Tgu-Mir-10-P2b3  Tgu-Mir-10-P2b4  Tgu-Mir-10-P3b  Tgu-Mir-10-P3c 
Orthologues Aae-Mir-10-P1-v1  Aae-Mir-10-P1-v2  Aca-Mir-10-P1a-v1  Aca-Mir-10-P1a-v2  Ami-Mir-10-P1a-v1  Ami-Mir-10-P1a-v2  Asu-Mir-10-P1  Bfl-Mir-10-P1-v1  Bfl-Mir-10-P1-v2  Bge-Mir-10-P1-v1  Bge-Mir-10-P1-v2  Bta-Mir-10-P1a-v1  Bta-Mir-10-P1a-v2  Cbr-Mir-10-P1  Cel-Mir-10-P1  Cfa-Mir-10-P1a-v1  Cfa-Mir-10-P1a-v2  Cgi-Mir-10-P1  Cli-Mir-10-P1a-v1  Cli-Mir-10-P1a-v2  Cpi-Mir-10-P1a-v1  Cpi-Mir-10-P1a-v2  Cpo-Mir-10-P1a-v1  Cpo-Mir-10-P1a-v2  Cte-Mir-10-P1  Dan-Mir-10-P1-v1  Dme-Mir-10-P1-v1  Dmo-Mir-10-P1-v1  Dno-Mir-10-P1a-v1  Dno-Mir-10-P1a-v2  Dpu-Mir-10-P1-v1  Dpu-Mir-10-P1-v2  Dre-Mir-10-P1a1-v1  Dre-Mir-10-P1a1-v2  Dre-Mir-10-P1a2-v1  Dre-Mir-10-P1a2-v2  Ete-Mir-10-P1a-v1  Ete-Mir-10-P1a-v2  Gga-Mir-10-P1a-v1  Gga-Mir-10-P1a-v2  Hme-Mir-10-P1-v1  Hme-Mir-10-P1-v2  Hsa-Mir-10-P1a-v1  Hsa-Mir-10-P1a-v2  Isc-Mir-10-P1-v1  Isc-Mir-10-P1-v2  Lgi-Mir-10-P1  Mdo-Mir-10-P1a-v1  Mdo-Mir-10-P1a-v2  Mml-Mir-10-P1a-v1  Mml-Mir-10-P1a-v2  Mmu-Mir-10-P1a-v1  Mmu-Mir-10-P1a-v2  Ocu-Mir-10-P1a-v1  Ocu-Mir-10-P1a-v2  Pfl-Mir-10-P1  Pmi-Mir-10-P1  Rno-Mir-10-P1a-v1  Rno-Mir-10-P1a-v2  Sha-Mir-10-P1a-v1  Sha-Mir-10-P1a-v2  Sko-Mir-10-P1  Spu-Mir-10-P1  Tca-Mir-10-P1-v1  Tca-Mir-10-P1-v2  Xtr-Mir-10-P1a-v1  Xtr-Mir-10-P1a-v2 
Node of Origin (gene) Vertebrata
Node of Origin (family) Eumetazoa
Genome context
(taeGut3.2.4)
gnl|ti|1257183866: 637-699 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-10-P1a-v1)
Mir-10-P1a-v2 gnl|ti|1257183866: 638-698 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCGAGGAGGACGCAACUGUCUUUCUAUAUGUACCCUGUAGAUCCGAAUUUGUGUAAAAGGAAGUUGGGUCACAAAUUCGUAUCUAGGGGAAUAUGUAGUUGACACAAACACUACAAACUCAGG
Get precursor sequence
Structure
        10           20        30        40        50        60 
CCGAGGAGGACGCAACU---|  UUU        A    G     C         GUAAAAGG 
                    GUC   CUAUAUGU CCCU UAGAU CGAAUUUGU        A
                    CAG   GAUGUAUA GGGG AUCUA GCUUAAACA        A
GGACUCAAACAUCACAAACA^  UU-        A    -     U         CUGGGUUG 
 120       110       100         90         80        70
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archives.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Mature sequence

Tgu-Mir-10-P1a-v1_5p

MirBase accessionMIMAT0018618
Sequence
0- UACCCUGUAGAUCCGAAUUUGU -22
Get sequence
Seed sequenceACCCUGU
Star sequence

Tgu-Mir-10-P1a-v1_3p*

MirBase accessionMIMAT0027035
Sequence
42- AAAUUCGUAUCUAGGGGAAUA -63
Get sequence