MirGeneDB

Gene name

Tgu-Let-7-P14

Family name LET-7 (all species)
MiRBase ID tgu-let-7e
Paralogues Tgu-Let-7-P1  Tgu-Let-7-P3c  Tgu-Let-7-P3d  Tgu-Let-7-P4  Tgu-Let-7-P5  Tgu-Let-7-P6  Tgu-Let-7-P7  Tgu-Let-7-P8  Tgu-Let-7-P11a  Tgu-Let-7-P11b  Tgu-Let-7-P12  Tgu-Let-7-P13 
Orthologues Aae-Let-7  Aca-Let-7-P14  Ami-Let-7-P14  Bge-Let-7  Cgi-Let-7  Cli-Let-7-P14  Cpi-Let-7-P14  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dpu-Let-7  Dre-Let-7-P14a  Gga-Let-7-P14  Hme-Let-7  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Pfl-Let-7  Pmi-Let-7  Sko-Let-7  Spu-Let-7  Tca-Let-7 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(taeGut3.2.4)
26: 532995-533065 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Let-7-P14)
Let-7-P13 26: 532802-532879 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCUGCCAUGGUCCCAAGCUGUCCUUGAGGCUGAGGUAGUAGAUUGAAUAGUUGUGGAGUCUGGUCCUCCCUCUGAGCUAACUAUACAAUCUACUGUCUUUCCUAAGGAGACAGUCAGGUCUUCAGGUCUGC
Get precursor sequence
Structure
        10         20         30        40        50        60     
GCUGCCAUGGUCCCAAG-     -|  G   CU   GU         A      GUGGAGUCUGGU 
                  CUGUC CUU AGG  GAG  AGUAGAUUG AUAGUU            C
                  GACAG GGA UCC  UUC  UCAUCUAAC UAUCAA            C
CGUCUGGACUUCUGGACU     A^  A   U-   UG         A      UCGAGUCUCCCU 
 .       120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsUGUG in loop
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Mature sequence

Tgu-Let-7-P14_5p

MirBase accessionMIMAT0014518
Sequence
0- UGAGGUAGUAGAUUGAAUAGUU -22
Get sequence
Seed sequenceGAGGUAG
Star sequence

Tgu-Let-7-P14_3p*

MirBase accessionMIMAT0026982
Sequence
50- CUAUACAAUCUACUGUCUUUC -71
Get sequence