MirGeneDB

Gene name

Tgu-Let-7-P11b

Family name LET-7 (all species)
MiRBase ID tgu-let-7g-2
Paralogues Tgu-Let-7-P1  Tgu-Let-7-P3c  Tgu-Let-7-P3d  Tgu-Let-7-P4  Tgu-Let-7-P5  Tgu-Let-7-P6  Tgu-Let-7-P7  Tgu-Let-7-P8  Tgu-Let-7-P11a  Tgu-Let-7-P12  Tgu-Let-7-P13  Tgu-Let-7-P14 
Orthologues Aae-Let-7  Aca-Let-7-P11  Ami-Let-7-P11  Bge-Let-7  Bta-Let-7-P11  Cfa-Let-7-P11  Cgi-Let-7  Cli-Let-7-P11  Cpi-Let-7-P11  Cpo-Let-7-P11  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P11  Dpu-Let-7  Dre-Let-7-P11  Ete-Let-7-P11  Gga-Let-7-P11  Hme-Let-7  Hsa-Let-7-P11  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mdo-Let-7-P11  Mml-Let-7-P11  Mmu-Let-7-P11  Ocu-Let-7-P11  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P11  Sha-Let-7-P11  Sko-Let-7  Spu-Let-7  Tca-Let-7  Xtr-Let-7-P11 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(taeGut3.2.4)
12: 6512032-6512109 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGACUUAAUUCCUGUUGCCUGAUUCCAGGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACCACCCGGUACAGGAGAUAACUGUACAGGCCACUGCCUUGCCUGGGACAGAGCACUGCCCUCAGUGAGGAU
Get precursor sequence
Structure
        10           20        30        40        50        60         
GGACUUAAUUCCUGUUGC---|  A        U        A            UGAGGGUCUAUGAUAC 
                     CUG UUCCAGGC GAGGUAGU GUUUGUACAGUU                \
                     GAC AGGGUCCG UUCCGUCA CGGACAUGUCAA                C
UAGGAGUGACUCCCGUCACGA^  -        -        C            UAGAGGACAUGGCCCA 
      130       120        110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Mature sequence

Tgu-Let-7-P11b_5p

MirBase accessionMIMAT0014528
Sequence
0- UGAGGUAGUAGUUUGUACAGUU -22
Get sequence
Seed sequenceGAGGUAG
Star sequence

Tgu-Let-7-P11b_3p*

MirBase accessionMIMAT0026986
Sequence
57- CUGUACAGGCCACUGCCUUGC -78
Get sequence