MirGeneDB

Gene name

Tca-Mir-970

Family name MIR-970 (all species)
MiRBase ID tca-mir-970
Paralogues
Orthologues Dme-Mir-970 
Node of Origin (gene) Endopterygota
Node of Origin (family) Endopterygota
Genome context
(Tcas5.2)
LG2: 10959586-10959647 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CGAACCAUGAAGAUAAACGAUGCCGGCGGCAGCUCAGCGUGUGUCGUACUGAUAGUGUUAUCACUAGCUAUCAUAAGACACACGCGGCUAUCGCCGGUCUCUCCUAUCCUUUUGAUUUUAUU
Get precursor sequence
Structure
        10           20        30        40        50        60 
CGAACCAUGAAGAUAAAC---| U       GC    CA         GUAC     GUGUUA 
                     GA GCCGGCG  AGCU  GCGUGUGUC    UGAUA      U
                     CU UGGCCGC  UCGG  CGCACACAG    ACUAU      C
UUAUUUUAGUUUUCCUAUCCU^ C       UA    --         AAU-     CGAUCA 
120       110       100        90          80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Star sequence

Tca-Mir-970_5p*

MirBase accessionMIMAT0019179
Sequence
0- AGCUCAGCGUGUGUCGUACUGAUA -24
Get sequence
Mature sequence

Tca-Mir-970_3p

MirBase accessionMIMAT0010092
Sequence
40- UCAUAAGACACACGCGGCUAUC -62
Get sequence
Seed sequenceCAUAAGA