MirGeneDB

Gene name

Tca-Mir-932

Family name MIR-932 (all species)
MiRBase ID tca-mir-932
Paralogues
Orthologues Dme-Mir-932 
Node of Origin (gene) Endopterygota
Node of Origin (family) Endopterygota
Genome context
(Tcas5.2)
LG5: 14056897-14056957 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CAGGAUUGUCGUCCUUCGGAGUGCGUGUCUUCAAUUCCGUAGUGCAUUGCAGUGUUUGUAGCAGCAGUCUGCAAGCAGUGCGGAAGUGAGGAUUCGUCUCUGCUAUCCUUCAAGCGUGUUC
Get precursor sequence
Structure
        10           20        30        40        50        60
CAGGAUUGUCGUCCUUC---|   U   U       A       G   A      UGUUUGU 
                    GGAG GCG GUCUUCA UUCCGUA UGC UUGCAG       A
                    UCUC UGC UAGGAGU AAGGCGU ACG AACGUC       G
CUUGUGCGAACUUCCUAUCG^   -   U       G       G   -      UGACGAC 
 .       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Mature sequence

Tca-Mir-932_5p

MirBase accessionMIMAT0008392
Sequence
0- UCAAUUCCGUAGUGCAUUGCAGU -23
Get sequence
Seed sequenceCAAUUCC
Star sequence

Tca-Mir-932_3p*

MirBase accessionMIMAT0019132
Sequence
39- UGCAAGCAGUGCGGAAGUGAGG -61
Get sequence