MirGeneDB

Gene name

Tca-Mir-9-o7-v2

Family name MIR-9 (all species)
MiRBase ID tca-mir-9e
Paralogues Tca-Mir-9-o3  Tca-Mir-9-o4  Tca-Mir-9-o5  Tca-Mir-9-o6-v1  Tca-Mir-9-o6-v2  Tca-Mir-9-o7-v1 
Orthologues Cte-Mir-9  Dme-Mir-9-P7  Isc-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (gene) T. castaneum
Node of Origin (family) Bilateria
Genome context
(Tcas5.2)
LG9: 11088-11145 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-9-o7-v2)
Mir-2-o56c LG9: 10977-11036 [-] Ensembl
Mir-9-o7-v1 LG9: 11087-11146 [-] Ensembl
Mir-279-o25 LG9: 11214-11274 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UGCAACAGGUUGCAAGUCGGAUAUAUUCUUCUUUGGUGAUCUAGUUGUAUGAGUGUUUUAUAUAUCAUAAAGCUGGUUCAGCAAAGCAGAUUGCAUUCGACUCUUCGACGAGCCGAGC
Get precursor sequence
Structure
        10          20        30        40        50        
UGCAACAGGUUGCAAGU--|    A  U   U     G   U      G     GUGUU 
                   CGGAU UA UCU CUUUG UGA CUAGUU UAUGA     U
                   GCUUA GU AGA GAAAC ACU GGUCGA AUACU     U
CGAGCCGAGCAGCUUCUCA^    C  U   C     G   U      A     AUAUA 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Mature sequence

Tca-Mir-9-o7-v2_5p

MirBase accessionMIMAT0023581
Sequence
0- CUUUGGUGAUCUAGUUGUAUGA -22
Get sequence
Seed sequenceUUUGGUG
Star sequence

Tca-Mir-9-o7-v2_3p*

MirBase accessionMIMAT0023582
Sequence
36- AUAAAGCUGGUUCAGCAAAGCA -58
Get sequence